minimal_example.out.uniprot.txt

#genome_nexus_version: 1.0.2
#isoform: uniprot
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_Position	End_Position	Strand	Consequence	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_File	Sequencer	t_ref_count	t_alt_count	n_ref_count	n_alt_count	HGVSc	HGVSp	HGVSp_Short	Transcript_ID	RefSeq	Protein_position	Codons	Exon_Number	genomic_location_explanation	Annotation_Status
PIK3CA	5290		GRCh37	3	178916927	178916939	+	protein_altering_variant	In_Frame_Del	DEL	TAGGCAACCGTGA	G	G																								ENST00000263967.3:c.314_326delinsG	p.Val105_Glu109delinsGly	p.V105_E109delinsG	ENST00000263967	NM_006218.2	105	gTAGGCAACCGTGAa/gGa	2/21		SUCCESS
EGFR	1956		GRCh37	7	55220240	55220240	+	splice_region_variant,synonymous_variant	Splice_Region	SNP	G	T	T																								ENST00000275493.2:c.630G>T		p.X210_splice	ENST00000275493	NM_005228.3	210	ctG/ctT	6/28		SUCCESS
EGFR	1956		GRCh37	7	55242468	55242486	+	protein_altering_variant	In_Frame_Del	DEL	ATTAAGAGAAGCAACATCT	AGCAA	GCAA																								ENST00000275493.2:c.2238_2256delinsGCAA	p.Leu747_Ser752delinsGln	p.L747_S752delinsQ	ENST00000275493	NM_005228.3	746	gaATTAAGAGAAGCAACATCT/gaGCAA	19/28	Start position changes from 55242467 to 55242468 is attributed to the presence of common bases A. Reference allele changes from AATTAAGAGAAGCAACATCT to ATTAAGAGAAGCAACATCT is attributed to the presence of common bases A. Variant allele changes from AGCAA to GCAA is attributed to the presence of common bases A.	SUCCESS