easybuild/easyconfigs/p/Perl/BioPerl-1.6.923_remove-broken-tests.patch

tests are broken, see https://rt.cpan.org/Public/Bug/Display.html?id=91880
diff -ruN t.orig/Seq/Seq.t t/Seq/Seq.t
--- t.orig/Seq/Seq.t	2013-12-18 06:12:53.000000000 +0100
+++ t/Seq/Seq.t	1970-01-01 01:00:00.000000000 +0100
@@ -1,222 +0,0 @@
-# -*-Perl-*- Test Harness script for Bioperl
-# $Id$
-
-use strict;
-
-BEGIN {
-    use lib '.';
-    use Bio::Root::Test;
-
-    test_begin(-tests => 73);
-
-    use_ok('Bio::Seq');
-    use_ok('Bio::Seq::RichSeq');
-    use_ok('Bio::SeqFeature::Generic');
-    use_ok('Bio::Species');
-    use_ok('Bio::Annotation::SimpleValue');
-}
-
-ok my $seq = Bio::Seq->new(-seq=>'ACTGTGGCGTCAACT',
-                        -desc=>'Sample Bio::Seq object',
-                        -alphabet => 'dna',
-                        -is_circular => 1
-                       );
-isa_ok($seq,"Bio::AnnotatableI");
-
-ok $seq->is_circular;
-ok not $seq->is_circular(0);
-ok not $seq->is_circular;
-
-my $trunc = $seq->trunc(1,4);
-is $trunc->length, 4, 'truncated sequence length';
-
-is $trunc->seq, 'ACTG', 'truncated sequence string';
-
-# test ability to get str function
-is $seq->seq(),  'ACTGTGGCGTCAACT' ;
-
-ok $seq = Bio::Seq->new(-seq=>'actgtggcgtcaact',
-                        -desc=>'Sample Bio::Seq object',
-                        -display_id => 'something',
-                        -accession_number => 'accnum',
-                        -alphabet => 'dna' );
-
-is uc $seq->alphabet, 'DNA' , 'alphabet';
-
-# basic methods
-
-is $seq->id(), 'something',  "id";
-is $seq->accession_number, 'accnum', "accession number";
-is $seq->subseq(5, 9),  'tggcg', "subseq";
-
-# check IdentifiableI and DescribableI interfaces
-isa_ok $seq, 'Bio::IdentifiableI';
-isa_ok $seq, 'Bio::DescribableI';
-# make sure all methods are implemented
-is $seq->authority("bioperl.org"), "bioperl.org";
-is $seq->namespace("t"), "t";
-is $seq->version(0), 0;
-is $seq->lsid_string(), "bioperl.org:t:accnum";
-is $seq->namespace_string(), "t:accnum.0";
-is $seq->description(), 'Sample Bio::Seq object';
-is $seq->display_name(), "something";
-
-# check that feature accession works regardless of lazy things going on
-is scalar($seq->top_SeqFeatures()), 0;
-is scalar($seq->flush_SeqFeatures()), 0;
-
-my $newfeat = Bio::SeqFeature::Generic->new( -start => 10,
-                                             -end => 12,
-                                             -primary => 'silly',
-                                             -source => 'stuff');
-
-
-$seq->add_SeqFeature($newfeat);
-is $seq->feature_count, 1;
-
-my $species = Bio::Species->new
-    (-verbose => 1,
-     -classification => [ qw( sapiens Homo Hominidae
-                              Catarrhini Primates Eutheria
-                              Mammalia Vertebrata Chordata
-                              Metazoa Eukaryota )]);
-$seq->species($species);
-is $seq->species->binomial, 'Homo sapiens';
-$seq->annotation->add_Annotation('description',
-                 Bio::Annotation::SimpleValue->new(-value => 'desc-here'));
-my ($descr) = $seq->annotation->get_Annotations('description');
-is $descr->value(), 'desc-here';
-is $descr->tagname(), 'description';
-
-#
-#  translation tests
-#
-
-my $trans = $seq->translate();
-is  $trans->seq(), 'TVAST' , 'translated sequence';
-
-# unambiguous two character codons like 'ACN' and 'GTN' should give out an amino
-# acid ...with the addendum that there should be no assumption by the method
-# to complete the codon unless specified, using the -complete_codons flag.
-
-$seq->seq('ACTGTGGCGTCAACN');
-$trans = $seq->translate();
-is $trans->seq(), 'TVAST', 'translated sequence with explicit unambiguous codons';
-
-$seq->seq('ACTGTGGCGTCAAC');
-$trans = $seq->translate();
-is $trans->seq(), 'TVAS', 'translated sequence with unknown unambiguous codons';
-
-$seq->seq('ACTGTGGCGTCAAC');
-$trans = $seq->translate(-complete_codons => 1);
-is $trans->seq(), 'TVAST', 'translated sequence with unknown unambiguous codons, completed';
-
-$seq->seq('ACTGTGGCGTCAACA');
-$trans = $seq->translate();
-is $trans->seq(), 'TVAST', 'translated sequence with unambiguous codons';
-
-$seq->seq('ACTGTGGCGTCAACAG');
-$trans = $seq->translate();
-is $trans->seq(), 'TVAST', 'translated sequence with unambiguous codons';
-
-$seq->seq('ACTGTGGCGTCAACAGT');
-$trans = $seq->translate(-complete_codons => 1);
-is $trans->seq(), 'TVASTV', 'translated sequence with unknown unambiguous codons, completed';
-
-$seq->seq('ACTGTGGCGTCAACAGTA');
-$trans = $seq->translate();
-is $trans->seq(), 'TVASTV', 'translated sequence with unambiguous codons';
-
-$seq->seq('AC');
-is $seq->translate(-complete_codons => 1)->seq , 'T', 'translated sequence with unknown unambiguous codons, completed';
-
-#difference between the default and full CDS translation
-
-$seq->seq('atgtggtaa');
-$trans = $seq->translate();
-is $trans->seq(), 'MW*' , 'translated sequence with stop';
-
-$seq->seq('atgtggtaa');
-$trans = $seq->translate(undef,undef,undef,undef,1);
-is $trans->seq(), 'MW', 'translated sequence';
-
-#frame
-my $string;
-my @frames = (0, 1, 2);
-foreach my $frame (@frames) {
-    $string .= $seq->translate(undef, undef, $frame)->seq;
-    $string .= $seq->revcom->translate(undef, undef, $frame)->seq;
-}
-is $string, 'MW*LPHCGYHVVTT';
-
-#Translating with all codon tables using method defaults
-$string = '';
-my @codontables = qw( 1 2 3 4 5 6 9 10 11 12 13 14 15 16 21 22 23);
-foreach my $ct (@codontables) {
-    $string .= $seq->translate(undef, undef, undef, $ct)->seq;
-}
-is $string, 'MW*MW*MW*MW*MW*MWQMW*MW*MW*MW*MW*MWYMW*MW*MW*MW*MW*';
-
-# CDS translation set to throw an exception for internal stop codons
-$seq->seq('atgtggtaataa');
-eval {
-    $seq->translate(undef, undef, undef, undef, 'CDS' , 'throw');
-};
-like ($@, qr/EX/);
-
-$seq->seq('atgtggtaataa');
-is( $seq->translate('J', '-',)->seq, 'MWJJ');
-
-# tests for RichSeq
-ok my $richseq = Bio::Seq::RichSeq->new( -seq => 'atgtggtaataa',
-                                      -accession_number => 'AC123',
-                                      -alphabet => 'rna',
-                                      -molecule => 'mRNA',
-                                      -id => 'id1',
-                                      -dates => [ '2001/1/1' ],
-                                      -pid => '887821',
-                                      -keywords => 'JUNK1;JUNK2',
-                                      -division => 'Fungi',
-                                      -secondary_accessions => 'AC1152' );
-
-is ($richseq->seq, 'atgtggtaataa');
-is ($richseq->display_id, 'id1');
-is (($richseq->get_dates)[0], '2001/1/1');
-is (($richseq->get_secondary_accessions)[0], 'AC1152');
-is ($richseq->accession_number, 'AC123');
-is ($richseq->alphabet, 'rna');
-is ($richseq->molecule, 'mRNA');
-is ($richseq->pid, 887821);
-is ($richseq->division, 'Fungi');
-is ($richseq->keywords, 'JUNK1; JUNK2');
-$richseq->seq_version('2');
-is ($richseq->seq_version, 2);
-
-# tests for subtle misbehaviors
-$seq = Bio::Seq->new(-primary_id => 'blah', -accession_number => 'foo');
-is ($seq->accession_number, $seq->primary_seq->accession_number);
-is ($seq->primary_id, $seq->primary_seq->primary_id);
-$seq->accession_number('blurb');
-$seq->primary_id('bar');
-is ($seq->accession_number, $seq->primary_seq->accession_number);
-is ($seq->primary_id, $seq->primary_seq->primary_id);
-
-
-# Bug #2864:
-
-$seq = Bio::Seq->new(-display_id => 0, -seq => 'GATC');
-
-is $seq->display_id, 0, "Bug #2864";
-
-# transcribe/rev_transcribe
-
-$seq = Bio::Seq->new( -id => 'seq1', -alphabet=>'dna',
-                      -seq=> 'attTcgcatgT' );
-ok my $xseq = $seq->transcribe;
-is $xseq->alphabet, 'rna';
-ok !($xseq->seq =~ /[tT]/);
-is $xseq->seq, 'auuUcgcaugU';
-ok !$xseq->transcribe;
-ok $seq = $xseq->rev_transcribe;
-is $seq->seq, 'attTcgcatgT';
-is $seq->alphabet, 'dna';
diff -ruN t.orig/SeqTools/SeqUtils.t t/SeqTools/SeqUtils.t
--- t.orig/SeqTools/SeqUtils.t	2013-12-18 06:12:53.000000000 +0100
+++ t/SeqTools/SeqUtils.t	1970-01-01 01:00:00.000000000 +0100
@@ -1,673 +0,0 @@
-# -*-Perl-*- Test Harness script for Bioperl
-# $Id$
-
-use strict;
-
-BEGIN {
-    use lib '.';
-#    use List::MoreUtils qw(uniq);
-    use Bio::Root::Test;
-    
-    test_begin(-tests => 133);
-
-    use_ok('Bio::PrimarySeq');
-    use_ok('Bio::SeqUtils');
-    use_ok('Bio::LiveSeq::Mutation');
-    use_ok('Bio::SeqFeature::Generic');
-    use_ok('Bio::Annotation::SimpleValue');
-    use_ok('Bio::Annotation::Collection');
-    use_ok('Bio::Annotation::Comment');
-}
-
-my ($seq, $util, $ascii, $ascii_aa, $ascii3);
-
-# Entire alphabet now IUPAC-endorsed and used in GenBank (Oct 2006)          
-$ascii =    'ABCDEFGHIJKLMNOPQRSTUVWXYZ';
-$ascii_aa = 'ABCDEFGHIJKLMNOPQRSTUVWXYZ';
-
-$ascii3 = 
-    'AlaAsxCysAspGluPheGlyHisIleXleLysLeuMetAsnPylProGlnArgSerThrSecValTrpXaaTyrGlx';
-
-$seq = Bio::PrimarySeq->new('-seq'=> $ascii,
-                            '-alphabet'=>'protein', 
-                            '-id'=>'test');
-
-# one letter amino acid code to three letter code
-ok $util = Bio::SeqUtils->new();
-is $util->seq3($seq), $ascii3;
-
-#using anonymous hash
-is (Bio::SeqUtils->seq3($seq), $ascii3); 
-is (Bio::SeqUtils->seq3($seq, undef, ','), 
-    'Ala,Asx,Cys,Asp,Glu,Phe,Gly,His,Ile,Xle,Lys,'.
-    'Leu,Met,Asn,Pyl,Pro,Gln,Arg,Ser,Thr,Sec,Val,Trp,Xaa,Tyr,Glx');
-
-$seq->seq('asd-KJJK-');
-is (Bio::SeqUtils->seq3($seq, '-', ':'), 
-    'Ala:Ser:Asp:Ter:Lys:Xle:Xle:Lys:Ter');
-
-# three letter amino acid code to one letter code
-ok (Bio::SeqUtils->seq3in($seq, 'AlaPYHCysAspGlu')); 
-is $seq->seq, 'AXCDE';
-is (Bio::SeqUtils->seq3in($seq, $ascii3)->seq, $ascii_aa);
-
-#
-# Tests for multiframe translations
-#
-
-$seq = Bio::PrimarySeq->new('-seq'=> 'agctgctgatcggattgtgatggctggatggcttgggatgctgg',
-                            '-alphabet'=>'dna', 
-                            '-id'=>'test2');
-
-my @a = $util->translate_3frames($seq);
-is scalar @a, 3;
-#foreach $a (@a) {
-#    print 'ID: ', $a->id, ' ', $a->seq, "\n";
-#}
-
-@a = $util->translate_6frames($seq);
-is scalar @a, 6;
-#foreach $a (@a) {
-#    print 'ID: ', $a->id, ' ', $a->seq, "\n";
-#}
-
-#
-# test for valid AA return
-#
-
-my @valid_aa = sort Bio::SeqUtils->valid_aa;
-is(@valid_aa, 27);
-is($valid_aa[1], 'A');
-
-@valid_aa = sort Bio::SeqUtils->valid_aa(1);
-is(@valid_aa, 27);
-is ($valid_aa[1], 'Arg');
-
-my %valid_aa = Bio::SeqUtils->valid_aa(2);
-is keys %valid_aa, 54;
-is($valid_aa{'C'}, 'Cys');
-is( $valid_aa{'Cys'}, 'C');
-
-
-#
-# Mutate
-#
-
-my $string1 = 'aggt';
-$seq = Bio::PrimarySeq->new('-seq'=> 'aggt',
-                            '-alphabet'=>'dna',
-                            '-id'=>'test3');
-
-# point
-Bio::SeqUtils->mutate($seq,
-                      Bio::LiveSeq::Mutation->new(-seq => 'c',
-                                                  -pos => 3
-                                                 )
-                     );
-is $seq->seq, 'agct';
-
-# insertion and deletion
-my @mutations = (
-                 Bio::LiveSeq::Mutation->new(-seq => 'tt',
-                                             -pos => 2,
-                                             -len => 0
-                                            ),
-                 Bio::LiveSeq::Mutation->new(-pos => 2,
-                                             -len => 2
-                                            )
-);
-
-Bio::SeqUtils->mutate($seq, @mutations);
-is $seq->seq, 'agct';
-
-# insertion to the end of the sequence
-Bio::SeqUtils->mutate($seq,
-                      Bio::LiveSeq::Mutation->new(-seq => 'aa',
-                                                  -pos => 5,
-                                                  -len => 0
-                                                 )
-                     );
-is $seq->seq, 'agctaa';
-
-
-
-#
-# testing Bio::SeqUtils->cat
-#
-
-# PrimarySeqs
-
-my $primseq1 = Bio::PrimarySeq->new(-id => 1, -seq => 'acgt', -description => 'master');
-my $primseq2 = Bio::PrimarySeq->new(-id => 2, -seq => 'tgca');
-
-Bio::SeqUtils->cat($primseq1, $primseq2);
-is $primseq1->seq, 'acgttgca';
-is $primseq1->description, 'master';
-
-#should work for Bio::LocatableSeq
-#should work for Bio::Seq::MetaI Seqs?
-
-
-# Bio::SeqI
-
-my $seq1 = Bio::Seq->new(-id => 1, -seq => 'aaaa', -description => 'first');
-my $seq2 = Bio::Seq->new(-id => 2, -seq => 'tttt', -description => 'second');
-my $seq3 = Bio::Seq->new(-id => 3, -seq => 'cccc', -description => 'third');
-
-
-#  annotations
-my $ac2 = Bio::Annotation::Collection->new();
-my $simple1 = Bio::Annotation::SimpleValue->new(
-                                                -tagname => 'colour',
-                                                -value   => 'blue'
-                                               ), ;
-my $simple2 = Bio::Annotation::SimpleValue->new(
-                                                -tagname => 'colour',
-                                                -value   => 'black'
-                                               ), ;
-$ac2->add_Annotation('simple',$simple1);
-$ac2->add_Annotation('simple',$simple2);
-$seq2->annotation($ac2);
-
-my $ac3 = Bio::Annotation::Collection->new();
-my $simple3 = Bio::Annotation::SimpleValue->new(
-                                                -tagname => 'colour',
-                                                -value   => 'red'
-                                               );
-$ac3->add_Annotation('simple',$simple3);
-$seq3->annotation($ac3);
-
-
-ok (Bio::SeqUtils->cat($seq1, $seq2, $seq3));
-is $seq1->seq, 'aaaattttcccc';
-is scalar $seq1->annotation->get_Annotations, 3;
-
-
-# seq features
-my $ft2 = Bio::SeqFeature::Generic->new( -start => 1,
-                                         -end => 4,
-                                         -strand => 1,
-                                         -primary => 'source',
-                                         -tag     => {note => 'note2'},
-                                       );
-
-
-my $ft3 = Bio::SeqFeature::Generic->new( -start => 3,
-                                         -end => 3,
-                                         -strand => 1,
-                                         -primary => 'hotspot',
-                                         -tag     => {note => ['note3a','note3b'],
-                                                      comment => 'c1'},
-                                       );
-
-$seq2->add_SeqFeature($ft2);
-$seq2->add_SeqFeature($ft3);
-
-my $seq1_length = $seq1->length;
-ok (Bio::SeqUtils->cat($seq1, $seq2));
-is $seq1->seq, 'aaaattttcccctttt';
-is scalar $seq1->annotation->get_Annotations, 5;
-is_deeply([uniq_sort(map{$_->get_all_tags}$seq1->get_SeqFeatures)], [sort qw(note comment)], 'cat - has expected tags');
-is_deeply([sort map{$_->get_tagset_values('note')}$seq1->get_SeqFeatures], [sort qw(note2 note3a note3b)], 'cat - has expected tag values');
-my @tags;
-lives_ok {
-  @tags = map{$_->get_tag_values(q(note))}$seq1->get_SeqFeatures ;
-} 'cat - note tag transfered (no throw)';
-cmp_ok(scalar(@tags),'==',3, 'cat - note tag values transfered (correct count)') ;
-my ($ft3_precat) = grep ($_->primary_tag eq 'hotspot', $seq2->get_SeqFeatures);
-is ($ft3_precat->start, 3, "get correct start of feature before 'cat'");
-my ($ft3_cat) = grep ($_->primary_tag eq 'hotspot', $seq1->get_SeqFeatures);
-is ($ft3_cat->start, 3+$seq1_length, "get correct start of feature after 'cat'");
-
-
-my $protseq = Bio::PrimarySeq->new(-id => 2, -seq => 'MVTF'); # protein seq
-
-throws_ok {
-    Bio::SeqUtils->cat($seq1, $protseq);
-} qr/different alphabets:/, 'different alphabets' ;
-
-
-#
-# evolve()
-#
-
-$seq = Bio::PrimarySeq->new('-seq'=> 'aaaaaaaaaa',
-                            '-id'=>'test');
-
-
-
-$util = Bio::SeqUtils->new(-verbose => 0);
-ok my $newseq = $util->evolve($seq, 60, 4);
-
-#  annotations
-
-$seq2 = Bio::Seq->new(-id => 2, -seq => 'ggttaaaa', -description => 'second');
-$ac3 = Bio::Annotation::Collection->new();
-$simple3 = Bio::Annotation::SimpleValue->new(
-                                                -tagname => 'colour',
-                                                -value   => 'red'
-                                            );
-$ac3->add_Annotation('simple',$simple3);
-$seq2->annotation($ac3);
-$ft2 = Bio::SeqFeature::Generic->new( -start => 1,
-                                      -end => 4,
-                                      -strand => 1,
-                                      -primary => 'source',
-                                      -tag     => {note => 'note2'},
-                                    );
-
-
-$ft3 = Bio::SeqFeature::Generic->new( -start => 5,
-                                      -end => 8,
-                                      -strand => -1,
-                                      -primary => 'hotspot',
-                                      -tag     => {note => ['note3a','note3b'], 
-                                                   comment => 'c1'},
-                                    );
-
-my $ft4 = Bio::SeqFeature::Generic->new(-primary => 'CDS');
-$ft4->location(Bio::Location::Fuzzy->new(-start=>'<1',
-					 -end=>5,
-					 -strand=>-1));
-
-$seq2->add_SeqFeature($ft2);
-$seq2->add_SeqFeature($ft3);
-$seq2->add_SeqFeature($ft4);
-
-my $trunc=Bio::SeqUtils->trunc_with_features($seq2, 2, 7);
-is $trunc->seq, 'gttaaa';
-my @feat=$trunc->get_SeqFeatures;
-is $feat[0]->location->to_FTstring, '<1..3';
-is $feat[1]->location->to_FTstring, 'complement(4..>6)';
-is $feat[2]->location->to_FTstring, 'complement(<1..4)';
-is_deeply([uniq_sort(map{$_->get_all_tags}$trunc->get_SeqFeatures)], [sort qw(note comment)], 'trunc_with_features - has expected tags');
-is_deeply([sort map{$_->get_tagset_values('note')}$trunc->get_SeqFeatures], [sort qw(note2 note3a note3b)], 'trunc_with_features - has expected tag values');
-
-my $revcom=Bio::SeqUtils->revcom_with_features($seq2);
-is $revcom->seq, 'ttttaacc';
-my ($rf1) = $revcom->get_SeqFeatures('hotspot');
-is $rf1->primary_tag, $ft3->primary_tag, 'primary_tag matches original feature...';
-is $rf1->location->to_FTstring, '1..4', 'but tagged sf is now revcom';
-
-my ($rf2) = $revcom->get_SeqFeatures('source');
-is $rf2->primary_tag, $ft2->primary_tag, 'primary_tag matches original feature...';
-is $rf2->location->to_FTstring, 'complement(5..8)', 'but tagged sf is now revcom';
-
-my ($rf3) = $revcom->get_SeqFeatures('CDS');
-is $rf3->primary_tag, $ft4->primary_tag, 'primary_tag matches original feature...';
-is $rf3->location->to_FTstring, '4..>8', 'but tagged sf is now revcom';
-
-is_deeply([uniq_sort(map{$_->get_all_tags}$revcom->get_SeqFeatures)], [sort qw(note comment)], 'revcom_with_features - has expected tags');
-is_deeply([sort map{$_->get_tagset_values('note')}$revcom->get_SeqFeatures], [sort qw(note2 note3a note3b)], 'revcom_with_features - has expected tag values');
-# check circularity
-isnt($revcom->is_circular, 1, 'still not circular');
-$seq3 = Bio::Seq->new(-id => 3, -seq => 'ggttaaaa', -description => 'third', -is_circular => 1);
-is(Bio::SeqUtils->revcom_with_features($seq3)->is_circular, 1, 'still circular');
-
-
-# delete, insert and ligate
-# prepare some sequence objects
-my $seq_obj = Bio::Seq->new( 
-  -seq =>'aaaaaaaaaaccccccccccggggggggggtttttttttt',
-  -display_id => 'seq1',
-  -desc       => 'some sequence for testing'
-); 
-my $subfeat1 = Bio::SeqFeature::Generic->new(
-  -primary_tag => 'sf1',
-  -seq_id      => 'seq1',
-  -start       => 2,
-  -end         => 12
-);
-
-my $subfeat2 = Bio::SeqFeature::Generic->new(
-  -primary_tag => 'sf2',
-  -seq_id      => 'seq1',
-  -start       => 14,
-  -end         => 16
-);
-my $subfeat3 = Bio::SeqFeature::Generic->new(
-  -primary_tag => 'sf3',
-  -seq_id      => 'seq1',
-  -start       => 21,
-  -end         => 25
-);
-
-my $composite_feat1 = Bio::SeqFeature::Generic->new(
-  -primary_tag => 'comp_feat1',
-  -seq_id      => 'seq1',
-  -start       => 2,
-  -end         => 30
-);
-my $coll_sf = Bio::Annotation::Collection->new;
-$coll_sf->add_Annotation(
-  'comment', Bio::Annotation::Comment->new( '-text' => 'a comment on sf1')
-);
-$subfeat1->annotation($coll_sf);
-
-$composite_feat1->add_SeqFeature( $subfeat1);
-$composite_feat1->add_SeqFeature( $subfeat2);
-$composite_feat1->add_SeqFeature( $subfeat3);
-my $feature1 = Bio::SeqFeature::Generic->new(
-  -primary_tag => 'feat1',
-  -seq_id      => 'seq1',
-  -start       => 2,
-  -end         => 25
-);
-my $feature2 = Bio::SeqFeature::Generic->new(
-  -primary_tag => 'feat2',
-  -seq_id      => 'seq1',
-  -start       => 15,
-  -end         => 25,
-  -strand      => -1,
-);
-my $feature3 = Bio::SeqFeature::Generic->new(
-  -primary_tag => 'feat3',
-  -seq_id      => 'seq1',
-  -start       => 30,
-  -end         => 40
-);
-my $feature4 = Bio::SeqFeature::Generic->new(
-  -primary_tag => 'feat4',
-  -seq_id      => 'seq1',
-  -start       => 1,
-  -end         => 10
-);
-my $feature5 = Bio::SeqFeature::Generic->new(
-  -primary_tag => 'feat5',
-  -seq_id      => 'seq1',
-  -start       => 11,
-  -end         => 20
-);
-
-my $feature6 = Bio::SeqFeature::Generic->new(
-  -primary_tag => 'feat6',
-  -seq_id      => 'seq1',
-  -start       => 11,
-  -end         => 25
-);
-$seq_obj->add_SeqFeature( $composite_feat1, $feature1, $feature2, $feature3, $feature4, $feature5, $feature6);
-
-my $coll = Bio::Annotation::Collection->new;
-$coll->add_Annotation(
-  'comment', Bio::Annotation::Comment->new( '-text' => 'a comment on the whole sequence')
-);
-$seq_obj->annotation($coll);
-
-
-my $fragment_obj = Bio::Seq->new( 
-  -seq =>'atatatatat',
-  -display_id => 'fragment1',
-  -desc       => 'some fragment to insert'
-); 
-my $frag_feature1 = Bio::SeqFeature::Generic->new(
-  -primary_tag => 'frag_feat1',
-  -seq_id      => 'fragment1',
-  -start       => 2,
-  -end         => 4,
-  -strand      => -1,
-);
-$fragment_obj->add_SeqFeature( $frag_feature1 );
-my $frag_coll = Bio::Annotation::Collection->new;
-$frag_coll->add_Annotation(
-  'comment', Bio::Annotation::Comment->new( '-text' => 'a comment on the fragment')
-);
-$fragment_obj->annotation($frag_coll);
-
-# delete
-my $product;
-lives_ok(
-  sub {
-    $product = Bio::SeqUtils->delete( $seq_obj, 11, 20 );
-  },
-  "No error thrown when deleting a segment of the sequence"
-);
-
-my ($seq_obj_comment) = $seq_obj->annotation->get_Annotations('comment');
-my ($product_comment) = $product->annotation->get_Annotations('comment');
-is( $seq_obj_comment, $product_comment, 'annotation of whole sequence has been moved to new molecule');
-
-ok( 
-  grep ($_ eq 'deletion of 10bp', 
-    map ($_->get_tag_values('note'), 
-      grep ($_->primary_tag eq 'misc_feature', $product->get_SeqFeatures)
-    )
-  ),
-  "the product has an additional 'misc_feature' and the note specifies the lengths of the deletion'"
-);
-
-my ($composite_feat1_del) = grep ($_->primary_tag eq 'comp_feat1', $product->get_SeqFeatures);
-ok ($composite_feat1_del, "The composite feature is still present");
-isa_ok( $composite_feat1_del, 'Bio::SeqFeature::Generic');
-isa_ok( $composite_feat1_del->location, 'Bio::Location::Split', "a composite feature that spanned the deletion site has been split up, Location");
-
-is( $composite_feat1_del->get_SeqFeatures, 2, 'one of the sub-eatures of the composite feature has been deleted completely');
-my ($subfeat1_del) = grep ($_->primary_tag eq 'sf1', $composite_feat1_del->get_SeqFeatures);
-ok ($subfeat1_del, "sub-feature 1 of the composite feature is still present");
-is ($subfeat1->end, 12, "the original end of sf1 is 12");
-is ($subfeat1_del->end, 10, "after deletion, the end of sf1 is 1nt before the deletion site");
-is ($subfeat1->location->end_pos_type, 'EXACT', 'the original end location of sf1 EXACT');
-
-my ($subfeat1_comment) = $subfeat1->annotation->get_Annotations('comment');
-my ($subfeat1_del_comment) = $subfeat1_del->annotation->get_Annotations('comment');
-is( $subfeat1_comment, $subfeat1_del_comment, 'annotation of subeature 1 has been moved to new molecule');
-
-my ($feature1_del) = grep ($_->primary_tag eq 'feat1', $product->get_SeqFeatures);
-ok ($feature1_del, "feature1 is till present");
-isa_ok( $feature1_del->location, 'Bio::Location::Split', 'feature1 location has now been split by the deletion and location object');
-is( my @feature1_del_sublocs = $feature1_del->location->each_Location, 2, 'feature1 has two locations after the deletion');
-is( $feature1_del_sublocs[0]->start, 2, 'feature1 start is unaffected by the deletion');
-is( $feature1_del_sublocs[0]->end, 10, 'feature1 end of first split is 1nt before deletion site');
-is( $feature1_del_sublocs[1]->start, 11, 'feature1 start of second split is 1nt after deletion site');
-is( $feature1_del_sublocs[1]->end, 15, 'feature1 end of second split has been adjusted correctly');
-my @fd1_notes = $feature1_del->get_tag_values('note');
-is( @fd1_notes,1, 'split feature now has a note');
-is (shift @fd1_notes, '10bp internal deletion between pos 10 and 11', 'got the expected note about length and position of deletion');
-
-my ($feature3_del) = grep ($_->primary_tag eq 'feat3', $product->get_SeqFeatures);
-ok ($feature3_del, "feature3 is till present");
-is_deeply ( [$feature3_del->start, $feature3_del->end], [$feature3->start - 10, $feature3->end - 10], 'a feature downstream of the deletion site is shifted entirely by 10nt to the left');
-
-my ($feature4_del) = grep ($_->primary_tag eq 'feat4', $product->get_SeqFeatures);
-ok ($feature4_del, "feature4 is till present");
-is_deeply ( [$feature4_del->start, $feature4_del->end], [$feature4->start, $feature4->end], 'a feature upstream of the deletion site is not repositioned by the deletion');
-
-my ($feature2_del) = grep ($_->primary_tag eq 'feat2', $product->get_SeqFeatures);
-ok ($feature2_del, "feature2 is till present");
-is ( $feature2_del->start, 11, 'start pos of a feature that started in the deletion site has been altered accordingly');
-my @fd2_notes = $feature2_del->get_tag_values('note');
-is( @fd2_notes,1, 'feature 2 now has a note');
-is (shift @fd2_notes, "6bp deleted from feature 3' end", "note added to feature2 about deletion at 3' end");
-
-ok (!grep ($_->primary_tag eq 'feat5', $product->get_SeqFeatures), 'a feature that was completely positioned inside the deletion site is not present on the new molecule');
-
-my ($feature6_del) = grep ($_->primary_tag eq 'feat6', $product->get_SeqFeatures);
-ok ($feature6_del, "feature6 is till present");
-is ( $feature6_del->start, 11, 'start pos of a feature that started in the deletion site has been altered accordingly');
-is ( $feature6_del->end, 15, 'end pos of a feature that started in the deletion site has been altered accordingly');
-
-
-# insert
-lives_ok(
-  sub {
-    $product = Bio::SeqUtils->insert( $seq_obj, $fragment_obj, 10 );
-  },
-  "No error thrown when inserting a fragment into recipient sequence"
-);
-($seq_obj_comment) = $seq_obj->annotation->get_Annotations('comment');
-($product_comment) = $product->annotation->get_Annotations('comment');
-is( $seq_obj_comment, $product_comment, 'annotation of whole sequence has been moved to new molecule');
-
-my ($composite_feat1_ins) = grep ($_->primary_tag eq 'comp_feat1', $product->get_SeqFeatures);
-ok ($composite_feat1_ins, "The composite feature is still present");
-isa_ok( $composite_feat1_ins, 'Bio::SeqFeature::Generic');
-isa_ok( $composite_feat1_ins->location, 'Bio::Location::Split', "a composite feature that spanned the insertion site has been split up, Location");
-is( $composite_feat1_ins->get_SeqFeatures, 3, 'all of the parts of the composite feature are still present');
-
-my ($subfeat1_ins) = grep ($_->primary_tag eq 'sf1', $composite_feat1_ins->get_SeqFeatures);
-ok ($subfeat1_ins, "sub-feature 1 of the composite feature is still present");
-is ($subfeat1->end, 12, "the original end of sf1 is 12");
-is ($subfeat1_ins->end, $subfeat1->end + $fragment_obj->length, "after insertion, the end of sf1 has been shifted by the length of the insertion");
-isa_ok( $subfeat1_ins->location, 'Bio::Location::Split', 'sub-feature 1 (spans insertion site) is now split up and');
-is_deeply (
-  [$subfeat1->location->end_pos_type, $subfeat1->location->start_pos_type],
-  [$subfeat1_ins->location->end_pos_type, $subfeat1_ins->location->start_pos_type],
-  'the start and end position types of sub-feature1 have not changed'
-);
-($subfeat1_comment) = $subfeat1->annotation->get_Annotations('comment');
-my ($subfeat1_ins_comment) = $subfeat1_ins->annotation->get_Annotations('comment');
-is( $subfeat1_comment, $subfeat1_ins_comment, 'annotation of subeature 1 has been moved to new molecule');
-my @sf1ins_notes = $subfeat1_ins->get_tag_values('note');
-is( @sf1ins_notes,1, 'split feature now has a note');
-is (shift @sf1ins_notes, '10bp internal insertion between pos 10 and 21', 'got the expected note about length and position of insertion');
-
-my ($feature3_ins) = grep ($_->primary_tag eq 'feat3', $product->get_SeqFeatures);
-ok ($feature3_ins, "feature3 is till present");
-is_deeply ( 
-  [$feature3_ins->start, $feature3_ins->end],
-  [$feature3->start + $fragment_obj->length, $feature3->end + $fragment_obj->length],
-  'a feature downstream of the insertion site is shifted entirely to the left by the length of the insertion');
-
-my ($feature4_ins) = grep ($_->primary_tag eq 'feat4', $product->get_SeqFeatures);
-ok ($feature4_ins, "feature4 is till present");
-is_deeply ( [$feature4_ins->start, $feature4_ins->end], [$feature4->start, $feature4->end], 'a feature upstream of the insertion site is not repositioned');
-
-my ($frag_feature1_ins) = grep ($_->primary_tag eq 'frag_feat1', $product->get_SeqFeatures);
-ok( $frag_feature1_ins, 'a feature on the inserted fragment is present on the product molecule');
-is_deeply (
-  [$frag_feature1_ins->start, $frag_feature1_ins->end],
-  [12, 14],
-  'position of the feature on the insert has been adjusted to product coordinates'
-);
-is( $frag_feature1_ins->strand, $frag_feature1->strand, 'strand of the feature on insert has not changed');
-like( $product->desc, qr/some fragment to insert/, 'desctription of the product contains description of the fragment');
-like( $product->desc, qr/some sequence for testing/, 'desctription of the product contains description of the recipient');
-
-ok( 
-  grep ($_ eq 'inserted fragment', 
-    map ($_->get_tag_values('note'), 
-      grep ($_->primary_tag eq 'misc_feature', $product->get_SeqFeatures)
-    )
-  ),
-  "the product has an additional 'misc_feature' with note='inserted fragment'"
-);
-
-# ligate
-lives_ok(
-  sub {
-    $product = Bio::SeqUtils->ligate( 
-      -recipient => $seq_obj, 
-      -fragment  => $fragment_obj, 
-      -left      => 10, 
-      -right     => 31,
-      -flip      => 1
-    ); 
-  },
-  "No error thrown using 'ligate' of fragment into recipient"
-);
-
-is ($product->length, 30, 'product has the expected length');
-is ($product->subseq(11,20), 'atatatatat', 'the sequence of the fragment is inserted into the product');
-
-my ($inserted_fragment_feature) = grep( 
-  grep($_ eq 'inserted fragment', $_->get_tag_values('note')),
-  grep( $_->has_tag('note'), $product->get_SeqFeatures)
-);
-
-ok($inserted_fragment_feature, 'we have a feature annotating the ligated fragment');
-is_deeply ( 
-  [$inserted_fragment_feature->start, $inserted_fragment_feature->end],
-  [11, 20],
-  'coordinates of the feature annotating the ligated feature are correct'
-);
-
-my ($fragment_feat_lig) = grep ($_->primary_tag eq 'frag_feat1', $product->get_SeqFeatures);
-ok( $fragment_feat_lig, 'the fragment feature1 is now a feature of the product');
-is_deeply( [$fragment_feat_lig->start, $fragment_feat_lig->end], [17,19], 'start and end of a feature on the fragment are correct after insertion with "flip" option');
-
-
-SKIP: {
-    skip("Storable::dclone not supported yet for Bio::SeqUtils, see ", 9) if $Bio::Root::Root::CLONE_CLASS eq 'Storable';
-
-    # test clone_obj option (create new objects via clone not 'new')
-    my $foo_seq_obj = Bio::Seq::Foo->new(
-      -seq =>'aaaaaaaaaaccccccccccggggggggggtttttttttt',
-      -display_id => 'seq1',
-      -desc       => 'some sequence for testing'
-    );
-    for ($composite_feat1, $feature1, $feature2, $feature3, $feature4, $feature5) {
-        $foo_seq_obj->add_SeqFeature( $_ );
-    }
-    $foo_seq_obj->annotation($coll);
-
-    dies_ok(
-      sub {
-        $product = Bio::SeqUtils->delete( $foo_seq_obj, 11, 20, { clone_obj => 0} );
-      },
-      "Trying to delete from an object of a custom Bio::Seq subclass that doesn't allow calling 'new' throws an error"
-    );
-
-    lives_ok(
-      sub {
-        $product = Bio::SeqUtils->delete( $foo_seq_obj, 11, 20, { clone_obj => 1} );
-      },
-      "Deleting from Bio::Seq::Foo does not throw an error when using the 'clone_obj' option to clone instead of calling 'new'"
-    );
-
-    isa_ok( $product, 'Bio::Seq::Foo');
-
-    # just repeat some of the tests for the cloned feature
-    ok(
-      grep ($_ eq 'deletion of 10bp',
-        map ($_->get_tag_values('note'),
-          grep ($_->primary_tag eq 'misc_feature', $product->get_SeqFeatures)
-        )
-      ),
-      "the product has an additional 'misc_feature' and the note specifies the lengths of the deletion'"
-    );
-    ($composite_feat1_del) = grep ($_->primary_tag eq 'comp_feat1', $product->get_SeqFeatures);
-    ok ($composite_feat1_del, "The composite feature is still present");
-    isa_ok( $composite_feat1_del, 'Bio::SeqFeature::Generic');
-    isa_ok( $composite_feat1_del->location, 'Bio::Location::Split', "a composite feature that spanned the deletion site has been split up, Location");
-
-    # ligate with clone_obj
-    dies_ok(
-      sub {
-        $product = Bio::SeqUtils->ligate(
-          -recipient => $foo_seq_obj,
-          -fragment  => $fragment_obj,
-          -left      => 10,
-          -right     => 31,
-          -flip      => 1
-        );
-      },
-      "'ligate' without clone_obj option dies with a Bio::Seq::Foo object that can't call new"
-    );
-
-    lives_ok(
-      sub {
-        $product = Bio::SeqUtils->ligate(
-          -recipient => $foo_seq_obj,
-          -fragment  => $fragment_obj,
-          -left      => 10,
-          -right     => 31,
-          -flip      => 1,
-          -clone_obj => 1,
-        );
-      },
-      "'ligate' with clone_obj option works with a Bio::Seq::Foo object that can't call new"
-    );
-}
-
-sub uniq_sort {
-    my @args = @_;
-    my %uniq;
-    @args = sort @args;
-    @uniq{@args} = (0..$#args);
-    return sort {$uniq{$a} <=> $uniq{$b}} keys %uniq;
-}
-
-package Bio::Seq::Foo;
-
-use base 'Bio::Seq';
-
-sub can_call_new { 0 }