notebooks/01_python_basics.ipynb

{
 "cells": [
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "# Module 1 - Python basics <a id='0'></a>\n",
    "--------------------------"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### Table of Content <a id='toc'></a>\n",
    "\n",
    "[**Python basics**](#0)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;[Variables](#1)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;[Code indentation - the importance of white spaces in Python](#2)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;[Functions](#3)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[The help function - your best friend in Python](#4)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;[Reading and understanding errors](#5)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;[Micro Exercise 1](#6)  \n",
    "\n",
    "[**Object types: simple types**](#7)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;[Type conversion](#8)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;[Micro Exercise 2](#9)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;[Operators](#10)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;[Arithmetic operators](#11)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;[Comparison operators](#12)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;[Micro Exercise 3](#13)\n",
    "\n",
    "[**Object types: container types**](#14)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;[**Strings**](#15)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[Length of a string](#16)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[String concatenation](#17)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[String slicing](#18)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[Micro exercise 4](#19)  \n",
    "\n",
    "&nbsp;&nbsp;&nbsp;&nbsp;[**Lists and tuples**](#20)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[List and tuple slicing](#21)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[Mutability - an important difference between lists and tuples](#22)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[Manipulating lists: adding and removing elements](#23)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[From list to string, and back again ...](#24)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[Micro Exercise 5](#25)\n",
    "\n",
    "&nbsp;&nbsp;&nbsp;&nbsp;[**Dictionaries**](#26)\n",
    "\n",
    "[**Exercises 1.1 - 1.4**](#27)\n",
    "\n",
    "[**Additional Material**](#28)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;[Mutability of objects in Python](#29)  \n",
    "&nbsp;&nbsp;&nbsp;&nbsp;[A solution: explicit deep copy](#30)  "
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "## Python documentation and learning resources\n",
    "\n",
    "* **Official [python documentation](https://www.python.org/doc/)**: this is the official python documentation. It also contains some tutorials.\n",
    "* **[Alternative documentation](https://www.w3schools.com/python/python_reference.asp)**: reference for built-in functions and types (easier to read, and sometimes more complete than the `help()` function). \n"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "<br>\n",
    "<br>\n",
    "\n",
    "## Python basics <a id='0'></a>\n",
    "---------------------\n",
    "\n",
    "### Variables <a id='1'></a>\n",
    "In python, as in many programming language, **objects are stored in variables**.\n",
    "* A value is **assigned** to a variable using the **`=`** sign. \n",
    "* **Important:** unlike in mathematics, the `=` sign in python is directional: the variable name must\n",
    "  always be on the left of the `=`, and the value to assign to the variable on the right.  \n",
    "\n",
    "  Example:\n",
    "  ```python\n",
    "  a = 23    # Valid assignment.\n",
    "  8 = b     # NOT a valid assignment.\n",
    "  ```\n",
    "\n",
    "<br>\n",
    "\n",
    "When we create a variable, python associates the variable name to a section of your computer's memory (i.e. the [RAM](https://en.wikipedia.org/wiki/Random-access_memory)) which will contain the data for the variable.\n",
    "\n",
    "<img src=\"img/var_simple.png\" alt=\"representation of a simple variable in memory\" style=\"width:150px;\" />\n",
    "\n",
    "<br>\n",
    "\n",
    "In python, variables names must adhere to these restrictions:\n",
    "* Variable names must be **composed solely of uppercase and lowercase letters** (`A-Z`, `a-z`), \n",
    "  **digits** (`0-9`), and the **underscore** character `_`.\n",
    "* The **first character** of a variable name **cannot be a digit**.\n",
    "* By convention, **variable names starting with a single or double underscore `_`/`__` are reserved \n",
    "  for \"special\" variables** (class private attributes, \"magic\" variables).\n",
    "* Examples:\n",
    "    * `var_1` is a valid variable name.\n",
    "    * `1_var` is **not** a valid name (starts with a digit).\n",
    "    * `var-1` is **not** a valid name (contains a the non-authorized character `-`).\n",
    "    * `__var_1__` is valid, but **should not be used**, with the exception of very specific situations.\n",
    "\n",
    "<br>\n",
    "\n",
    "**Important tips**:\n",
    "* Using **explicit variable names makes your code easier to read** for others, and possibly yourself \n",
    "  in a not-so-distant future.  \n",
    "  E.g. `input_file` is a better variable name than `iptf`, even if it is a bit longer.\n",
    "* **Never use python built-in names as variable names**, otherwise you will overwrite this object in the \n",
    "  namespace.  \n",
    "  E.g. don't call a variable `str`, `int` or `list` (this can be painful to debug)."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "scrolled": true
   },
   "outputs": [],
   "source": [
    "my_variable = 35        # Assign the value 35 to the variable name \"my_variable\".\n",
    "var_a = \"hello python\"  # Assign the value \"hello python\" to variable \"var_a\".\n",
    "var_b = var_a           # Assign the value of \"var_a\" to \"var_b\".\n",
    "\n",
    "# By the way, text located after a \"#\" character - just like this line - are \"comments\".\n",
    "# Comments are text that will not be executed, but is useful for code documentation.\n",
    "print(my_variable)\n",
    "print(var_a)\n",
    "print(var_b)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "### Code indentation - the importance of white spaces in Python <a id='2'></a>\n",
    "\n",
    "**Indentation** is the number of **white spaces before the first text element** (on a given line).\n",
    "\n",
    "```python\n",
    "    |var_1 = 2    # This line is not indented.\n",
    "    | var_1 = 2   # This line is indented by 1 space.\n",
    "     ^\n",
    "    |  var_1 = 2  # This line is indented by 2 spaces.\n",
    "     ^^\n",
    "```\n",
    "\n",
    "* Unlike many other languages, **indentation is part of the language syntax in Python**,\n",
    "  and it has a very important meaning: it is used to define a so-called **\"code block\"**\n",
    "  (more on that later in the course).\n",
    "* Using proper **indentation is an integral part of python** - unlike most other languages where it's\n",
    "  just good practice.\n",
    "* When outside of a \"code block\", there should be no indentation on the line.\n",
    "* A wrong level of indentation will trigger an `IndentationError`.\n",
    "* Comments can have any indentation level."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "var_1 = \"abc\"    # No indentation -> valid syntax.\n",
    " var_1 = \"abc\"   # unexpected indentation (i.e. outside of a code block) -> IndentationError\n",
    " \n",
    "     # Comment lines, however, can be indented as you wish."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "When assigning a variable, white spaces after the variable name do not matter. However the [Python style convention](https://www.python.org/dev/peps/pep-0008/#whitespace-in-expressions-and-statements) is to have **exactly 1 space** on each side of the `=` operator when assigning a variable.\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "var_1 = \"abc\"                   # Valid syntax and good style.\n",
    "var_1           =        \"abc\"  # Valid syntax but bad style -> please avoid.\n",
    "print(var_1)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "### Functions <a id='3'></a>\n",
    "Another very important concept in Python - as in most programming language - are **functions**:\n",
    "* Functions are **re-usable blocks of code** that have been given a name and are designed to perform an action.\n",
    "  How to define your own functions will be covered in Module 2 of this course.\n",
    "* Functions can be written to perform anything, from the simplest task to the most complex.\n",
    "* To **call a function**, one uses its name followed by parentheses `()`, which can contain an eventual set of \n",
    "  **arguments**.\n",
    "* Values passed to functions are called **arguments**, they can be **mandatory** (positional arguments)\n",
    "  or **optional** (keyword arguments).\n",
    "\n",
    "**Example:** to call the \"print\" function, we type `print()` and pass the text to print inside the `()`.\n",
    "  "
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "print(\"This will be printed\")                     # 1 argument is passed to the print().\n",
    "print(\"This\", \"will\", \"be\", \"printed\", sep=\"--\")  # 5 arguments are passed to print()."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "#### Positional vs. keyword arguments\n",
    "\n",
    "**Arguments** are the variables/values that the function uses as input to do its job. \n",
    "\n",
    "Example of the `print()` function:\n",
    "\n",
    "    print(value, ..., sep=' ', end='\\n', file=sys.stdout, flush=False)\n",
    "\n",
    "> Note: the above line (function name + arguments) is often referred to as the function's **signature**.\n",
    "\n",
    "<br>\n",
    "\n",
    "In Python, we differentiate between two types of arguments:\n",
    "  * **Positional** arguments:\n",
    "      * **Are mandatory** - the function will not execute without them.\n",
    "      * Their position in the call to the function is important.  \n",
    "        E.g. `divmod(11, 5)` - [which returns the quotient and remainder of a \n",
    "        division](https://docs.python.org/3/library/functions.html#divmod) - \n",
    "        does not give the same result as `divmod(5, 11)`.\n",
    "\n",
    "<br>\n",
    "\n",
    "  * **Keyword** arguments:\n",
    "      * **Are optional** and have a **default value**.\n",
    "      * Are passed to the function with the syntax `function(argument_name=value)`.\n",
    "      * Keyword arguments **can be passed in any order**... as long as they are passed\n",
    "        **after positional arguments**."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "answer = 42\n",
    "print(\"The answer is\", answer, sep=\" -> \", end=\"--\\n\")\n",
    "print(\"The answer is\", answer, end=\"--\\n\", sep=\" -> \")"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "**Positional** arguments must always be passed **before keyword arguments**. Otherwise, a **`SyntaxError`** is raised:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "print(sep=\"--\", \"This\", \"will\", \"be\", \"printed\")   #  -> raises a SyntaxError"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Very often (but not always, it depends on the function), keyword arguments can also be passed without their name being specified - in which case they must be passed in the correct order:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "scrolled": true
   },
   "outputs": [],
   "source": [
    "# In the print function, all keyword arguments must be passed with their name.\n",
    "print(\"This\", \"will\", \"be\", \"printed\", sep=\"--\")\n",
    "print(\"This\", \"will\", \"be\", \"printed\", \"--\")"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "#### The help function - your best friend in Python <a id='4'></a>\n",
    "In python, almost any object or function is extensively documented: what it is, what it does, how to use it, ...  \n",
    "This information is accessed using the `help()` function, which takes as argument the object we want to get help with.\n",
    "\n",
    "Let's try to look up the help page of the `print()` function that we encountered moments ago:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "help(print)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "**It tells us that:**\n",
    " * `print` is a function (more specifically a **built-in** function).\n",
    " * It gives a description of what `print()` does:\n",
    " \n",
    "   > Prints the values to a stream, or to sys.stdout by default.\n",
    "   \n",
    "   So the function prints the values that are passed to it to the console (or possibly to a file).\n",
    " * It takes one or more positional (mandatory) arguments `args` (or `value` in the help of older python\n",
    "   versions), which are the things that will be printed.\n",
    "   * Note that `print()` is a bit of a special case, as it is possible to pass multiple values for\n",
    "     the first argument.\n",
    "   * The fact that multiple arguments can be passed is indicated by the `*` (or `...` on older\n",
    "     python versions).\n",
    "     \n",
    " * It has 4 optional keyword arguments that refine its use, among which are `sep` and `end`.\n",
    " * The **default values** for the keyword arguments are shown in the function's signature:\n",
    " \n",
    "    > print(value, ..., sep=' ', end='\\n', file=sys.stdout, flush=False)\n",
    "    \n",
    "    E.g. the default value for `sep` is a single white space (` `), and the default for `end` is\n",
    "    the \"new line\" (`\\n`) character.\n",
    "\n",
    "<br>\n",
    "\n",
    "Let's try to apply our new knowledge of the `print` function :"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Simple usage.\n",
    "print(\"test\")\n",
    "\n",
    "# We can make it print several values by passing several arguments. By default, they are separated by 1 space.\n",
    "print(\"Please collect\" , 42, \"Shrubberies\")\n",
    "\n",
    "# The \"sep\" argument can be used to change the separator between values.\n",
    "print(\"Please collect\" , 42, \"Shrubberies\", sep=\"/\")\n",
    "\n",
    "# The 'end' argument can be used to modify the character printed at\n",
    "# the end of each line. It defaults to \"\\n\", the new line character.\n",
    "print(\"first line\", end=\"\")\n",
    "                             \n",
    "print(\"second line\")"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "**Don't hesitate to use the `help` function on any object (e.g. functions) to understand how they work.**"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "### Methods\n",
    "\n",
    "**Methods** are very similar to functions, except that they **are associated to a specific object type**.  \n",
    "Since methods are associated to a specific object type, the syntax used to call them is the following:\n",
    "\n",
    "* `object.method()` - syntax to call a **method of an object**.\n",
    "\n",
    "\n",
    "<br>\n",
    "\n",
    "**Example:** calling the `.upper()` method of a string."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "test_string = \"hello world!\"\n",
    "upper_case_string = test_string.upper()\n",
    "\n",
    "print(upper_case_string)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "> **Important:** don't forget the `()` when calling a method/function that takes no arguments.\n",
    "> Otherwise you will not call the method/function, but access the \"function object\" itself.\n",
    ">\n",
    "> ```python\n",
    "> test_string.upper()  # -> calls the \"upper\" method on \"test_string\".\n",
    "> test_string.upper    # -> returns a function object.\n",
    "> ```"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "**Methods are a very important part of python**, and provide tons of functionalities to objects.  \n",
    "Before you start writing your own code to manipulate an object, **always check** if the object\n",
    "already has a method that does exactly (or nearly) what you want.\n",
    "This will save you a lot of time and grief.\n",
    "\n",
    "\n",
    "In the help, **methods can be identified** by the fact that their first argument is the special keyword **`self`**.\n",
    "\n",
    "Example of `help(str.upper)`:\n",
    "\n",
    "```py\n",
    "upper(self, /)\n",
    "    Return a copy of the string converted to uppercase.\n",
    "```\n",
    "\n",
    "<br>\n",
    "\n",
    "> Notes:\n",
    "> * To get the help of an object method, you need to specify it's class: `help(class.method)`\n",
    ">   * `help(str.upper)` works.\n",
    ">   * But `help(upper)` does not.\n",
    ">\n",
    ">   <br>  \n",
    ">\n",
    "> * The `/` symbol found in method/function signatures indicates that all arguments\n",
    ">   present before the `/` can only be passed as positional arguments, even if they have\n",
    ">   a default value. In other words:\n",
    ">   * These arguments **cannot be passed with their argument name**, i.e. `argument_name=value`.\n",
    ">   * These arguments have to be **passed in the correct order**.\n",
    ">   \n",
    ">   In the case of the `str.upper()` method, this information is not very meaningful as this\n",
    ">   method does not take any argument (well, technically you could write `str.upper(\"hello world\")`\n",
    ">   but nobody does this).\n",
    ">\n",
    ">   However, if we consider e.g. the builtin `divmod` function, the `/` in its signature\n",
    ">   has practical implications:\n",
    ">\n",
    ">   ```python\n",
    ">   help(divmod)       # -> divmod(x, y, /)\n",
    ">   divmod(x=23, y=7)  # -> Not allowed, raises a TypeError: divmod() takes no keyword arguments\n",
    ">   divmod(23, 7)      # -> OK\n",
    ">   ```"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "### Reading and understanding errors <a id='5'></a>\n",
    "\n",
    "Unless you are a perfect human being, your code will contain errors at some point.  \n",
    "Errors ~~can sometimes be~~ are frustrating, but they are unavoidable, and the best way to correct them is to read and try to understand them.\n",
    "\n",
    "Here is an error example:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "scrolled": true
   },
   "outputs": [],
   "source": [
    "var_a = 42\n",
    "var_b = var_a + 3\n",
    "print(var_c)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "The python error message gives us a number of useful info:\n",
    "* The first line indicates the **type** of the error. In our example we got a `NameError`, meaning that \n",
    "  a name (of an object) has not been found, which means that there is no variable/function/class with said\n",
    "  name currently defined. If you want to know more about a certain error type, you can use the help \n",
    "  function on it: `help(NameError)`.\n",
    "* The following lines indicate **where the error occurred**, which is very useful when there are hundreds of \n",
    "  lines in your code. Here the error occurred on line `3` (as indicated by the arrow `----> 3`).\n",
    "* Finally, we have the **error message**: `NameError: name 'var_c' is not defined`. This points out\n",
    "  that we tried to access a variable named `var_c`, when in fact that variable does not exist (i.e., that name\n",
    "  is not defined).\n",
    "\n",
    "> <span style=\"color:blue\">Arguably, being able to **read and understand errors** and being able to **read the help** accounts for ~50% of \"coding skills\"...</span>.\n",
    "\n"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "<div class=\"alert alert-block alert-success\">\n",
    "    \n",
    "### Micro Exercise 1 <a id='6'></a>\n",
    "* Copy/paste the line below in a code cell and execute it.\n",
    "    ```python\n",
    "    a = 10\n",
    "    42 + \"a\"\n",
    "    ```\n",
    "    <br>\n",
    "    \n",
    "* Look at the error that was raised. Try to understand it, and modify the code to fix it.\n",
    "\n",
    "<div>\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "## Object types: simple types <a id='7'></a>\n",
    "\n",
    "**Everything in python is an object**, and each object is of a specific **type** (the type is the class of the object).\n",
    "\n",
    "There exist plenty of types (it is even common to define your own new type), but there are a few very common ones - known as **built-in** types - that you ought to know:\n",
    "\n",
    "* **`bool`**: boolean/logical values, either `True` or `False`, like 0 or 1.\n",
    "* **`int`**: integer number.\n",
    "* **`float`**: floating point number (numbers with a decimal fraction).\n",
    "\n",
    "To know the type of an object, we can make use of the **`type()`** function.  \n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "print(type(True))\n",
    "print(type(11))\n",
    "print(type(\"hello world\"))\n",
    "print(type(print))"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "**A few comments about types in python:**\n",
    "* Python is a **dynamically typed** language\\*\\* (as opposed to **statically typed** \n",
    "  languages such as C or C++ e.g.). This means that variables are declared without a specific type, \n",
    "  and the type is assigned based on what object is assigned to the variable.  \n",
    "  This has its advantages (easier and faster to write code) and downsides (e.g. type error bugs can \n",
    "  remain hidden for a long time until they are triggered by some unusual input data).\n",
    "\n",
    "  \\*\\* Starting with python 3.6, it is possible (as an option) to add **type annotations** for\n",
    "  variables, but these are not enforced at runtime.\n",
    "  \n",
    "  <br>\n",
    "  \n",
    "* A corollary is that variables in Python are not restricted to a single type and can be reassigned \n",
    "  another type of value at any time.\n",
    " \n",
    "<br>\n",
    "\n",
    "**Example:** here we successively assign different values and types to the variable `a`."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "scrolled": true
   },
   "outputs": [],
   "source": [
    "# Boolean\n",
    "a = True\n",
    "print(\"Type of a is now:\", type(a))\n",
    "\n",
    "# Float\n",
    "a = 4.2\n",
    "print(\"Type of a is now:\", type(a))\n",
    "\n",
    "# Integer\n",
    "a = 42\n",
    "print(\"Type of a is now:\", type(a))"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "### Type conversion <a id='8'></a>\n",
    "\n",
    "Converting from one type to another is (often) fairly easy: just use the type name as a function.\n",
    "\n",
    "**Example:** convert an integer to a float."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "a = 42\n",
    "print(\"Type of 'a' before conversion:\", type(a), \", a = \", a)\n",
    "\n",
    "a = float(a)\n",
    "print(\"Type of 'a' after conversion:\", type(a), \", a = \", a)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "**Example:** convert to string"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "a = str(a)\n",
    "print(\"Type of 'a' after conversion:\", type(a), \", a = \", a)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {
    "vscode": {
     "languageId": "python"
    }
   },
   "source": [
    "Converting to string is useful when concatenating a string and a number:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# This fails, because we cannot add strings and integers types.\n",
    "print(\"This will fail, \" + 2 + \" bad\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# This works, because we convert the integer 4 to a string \"4\" before the concatenation.\n",
    "print(\"This will work \" + str(4) + \" sure\")"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "<div class=\"alert alert-block alert-success\">\n",
    "\n",
    "### Micro Exercise 2 <a id='9'></a>\n",
    "* Set `a = \"42\"`, then convert `a` back to an integer (`int`). Look up the `help` for integers.  \n",
    "* If you have time, try to now set `a = \"42.0\"` and do the type conversion. Does it still work? If not, how\n",
    "  can you fix the issue?\n",
    "\n",
    "<div>"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "## Operators <a id='10'></a>\n",
    "Now that we have variables containing objects of a certain **type**, we can begin to manipulate them using **operators**.\n",
    "<br>\n",
    "\n",
    "### Arithmetic operators  <a id='11'></a>\n",
    "You know most of these already:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "scrolled": true
   },
   "outputs": [],
   "source": [
    "print( 3 + 7 )      # + : addition\n",
    "print( 1.1 - 5 )    # - : subtraction\n",
    "print( 5 * 2 )      # * : multiplication\n",
    "print( 5 / 2 )      # / : division\n",
    "print( 2 ** 4 )     # **: power\n",
    "print( 5 // 2 )     # //: integer division (only the integer part of the quotient is kept,\n",
    "                    #     the fractional part is discarded: 2.5 -> 2)\n",
    "print( 5 % 2 )      # % : modulus = remainder of the integer division: 5 % 2 -> 1\n",
    "\n",
    "# As you would expect, variables can be used with operators as well:\n",
    "x = 4\n",
    "y = 16 * x**2 - 2 * x + 0.5 \n",
    "print(y)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "**Tip:** when modifying the value of a variable, you can use the following **shortcut operators** (useful e.g. to increment the value of a variable in a loop):"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "a = 0\n",
    "print(\"The start value of 'a' is\", a)\n",
    "\n",
    "# Same as a = a + 3\n",
    "a += 3\n",
    "print(\"The value of 'a' is now:\", a)\n",
    "\n",
    "# Same as a = a - 1\n",
    "a -= 1                                 \n",
    "print(\"The value of 'a' is now:\", a)\n",
    "\n",
    "# Same as a = a * 3\n",
    "a *= 3\n",
    "print(\"The value of 'a' is now:\", a)\n",
    "\n",
    "# Same as a = a / 2\n",
    "a /= 2\n",
    "print(\"The value of 'a' is now:\", a)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "### Comparison operators <a id='12'></a>\n",
    "\n",
    "These operators return a `bool` value: `True` or `False`."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "a = 5\n",
    "\n",
    "print(\"is a equal to 1?:\", a == 1)              # == : equality\n",
    "print(\"is a different to 13.37?:\", a != 13.37)  # != : inequality\n",
    "print(\"is a greater than 5?:\", a > 5 )          # >  : larger than\n",
    "print(\"is a lower than 10?:\", a < 10 )          # <  : lower than\n",
    "print(\"is a above 5?:\", a >= 5 )                # <= : lower or equal\n",
    "print(\"is a lower than 10?:\", a <= 10 )         # >= : larger or equal"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "**Warning:** comparisons are type-sensitive, so the following expression evaluates to `False`:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "a = 5\n",
    "print(\"is 'a' equal to '5'?:\", a == \"5\")"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Boolean values (the result from a comparison) can be:\n",
    "* **Combined** using `and` or `or`:\n",
    "\n",
    "    | Combining with `and` | **True** | **False** |\n",
    "    |----------------------|----------|-----------|\n",
    "    | **True**             | True     |  False    |\n",
    "    | **False**            | Flase    |  False    |\n",
    "  \n",
    "    | Combining with `or`  | **True** | **False** |\n",
    "    |----------------------|----------|-----------|\n",
    "    | **True**             | True     |  True     |\n",
    "    | **False**            | True     |  False    |\n",
    "  \n",
    "  <br>\n",
    "  \n",
    "* **Inverted** using `not`: `True` becomes `False`, and `False` becomes `True`."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "a = 5\n",
    "\n",
    "print(\"'and' requires both elements to be True:\" , True and ( 1 + 1 != 2 ) )\n",
    "print(\"'or' requires at least element to be True:\" , ( a * 2 > 10 ) or ( a > 0 ) )\n",
    "print(\"'not' inverses a boolean value! This is simply\", not False)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "<div class=\"alert alert-block alert-success\">\n",
    "\n",
    "### Micro Exercise 3 <a id='13'></a>\n",
    "* Compute the product of 348 and 157.2.\n",
    "* Use a comparison operator to check if the result is larger than 230 square (`230 ** 2`)\n",
    "\n",
    "<div>"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "## Object types: container types <a id='14'></a>\n",
    "\n",
    "These built-in types are object that contain other objects:\n",
    "\n",
    "* **`str`**: string - text.\n",
    "* **`list`**: **mutable** list of objects (mutable = can be modified after it was created).\n",
    "* **`tuple`**: **immutable** list of objects (immutable = cannot be modified after it was created).\n",
    "* **`dict`**: dictionary associating 'key' to 'value'.\n",
    "\n",
    "Container objects share some common characteristics, such as:\n",
    "* They have a dedicated **`[]`** operator that lets user access one - or several - of the objects they contain.\n",
    "* The number of objects a container has (its length) can be accessed using the **`len()`** function.\n",
    "* Container objects are **iterables**: one can iterate over them using e.g. a `for` loop (see Notebook 2 of this course).\n",
    "\n",
    "**Important:** in python (unlike e.g. in R), **indexing is zero-based**. This means that the first element of a container type object is accessed with `object[0]`, and not `object[1]`."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "## Strings <a id='15'></a>\n",
    "In python, the **`string`** type is a **sequences of characters** that can be used to represent text of any length.\n",
    "\n",
    "* Strings can be declared using either **single `'`** or **double `\"`** quotes. "
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "scrolled": true
   },
   "outputs": [],
   "source": [
    "gene_seq = \"ATGCGACTGATCGATCGATCGATCGATGATCGATCGATCGATGCTAGCTAC\"\n",
    "name = 'Sir Lancelot of Camelot'\n",
    "print(gene_seq)\n",
    "print(name)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "In memory, this variable can be represented as follow:\n",
    "\n",
    "<img src=\"img/var_str1.png\" alt=\"representation of a string variable in memory\" style=\"width:250px;\" />\n",
    "\n",
    "Remember that strings are *container* variables, that is why we represent each letters as different elements.\n",
    "\n",
    "Each element is associated an **index**, starting at 0.\n",
    "\n",
    "<img src=\"img/var_str2_with_indexes.png\" alt=\"representation of a string variable in memory with indexes\" style=\"width:250px;\" />\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_str = \"text\"\n",
    "print(\"The second element of the string is:\", my_str[1])"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "* **Triple quotes** can be used to define multi-line strings."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "long_string = \"\"\"Let me tell you something, my lad. \n",
    "When you’re walking home tonight and some great \n",
    "homicidal maniac comes after you with a bunch \n",
    "of loganberries, don’t come crying to me!\\n\"\"\"\n",
    "print(long_string)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "* **Accented and special characters** are possible in strings. In example:\n",
    "  * **`\\t`** = tab\n",
    "  * **`\\n`** = new line"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_quote = \"\"\"Gracieux : « aimez-vous à ce point les oiseaux\n",
    "que paternellement vous vous préoccupâtes\n",
    "de tendre ce perchoir à leurs petites pattes ? »\\n\"\"\"\n",
    "print(my_quote)\n",
    "\n",
    "# Example of inserting a tab/new line in a string:\n",
    "print('Hello\\tWorld')  # \\t : tabulation\n",
    "print('Hello\\nWorld')  # \\n : newline"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "<div class=\"alert alert-block alert-success\">\n",
    "\n",
    "**Question:** why do these 2 lines print exactly the same text?\n",
    "\n",
    "</div>    "
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "print('Hello World')\n",
    "print('Hello World\\n', end=\"\")"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "* **Combining** single and double quotes."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "quote_in_quote_1 = \"Let me tell you 'something', my lad\"\n",
    "quote_in_quote_2 = 'Let me tell you \"something\", my lad'\n",
    "print(quote_in_quote_1)\n",
    "print(quote_in_quote_2)\n",
    "\n",
    "# Note: quotes can also be escaped, but it is a bit less readable than using different quote types.\n",
    "quote_in_quote_3 = \"Let me tell you \\\"something\\\", my lad\"\n",
    "print(quote_in_quote_3)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "### Length of a string <a id='16'></a>\n",
    "The **`len()`** function can be used on a string to return its length:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "name = 'Sir Lancelot of Camelot'\n",
    "print(\"The number of characters in the string '\", name, \"' is: \", len(name), sep='')"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "### String concatenation <a id='17'></a>\n",
    "* Strings can be concatenated with the **`+`** operator.\n",
    "* Strings can be \"multiplied\" (i.e. repeatedly concatenated) with the **`*`** operator."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "print(\"dead\" + \"-\" + \"parrot\") \n",
    "print(\"spam\" * 5)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<div class=\"alert alert-block alert-info\">\n",
    "\n",
    "#### [Additional Material] f-strings\n",
    "\n",
    "Python [f-strings (formatted string literals)](https://docs.python.org/3/reference/lexical_analysis.html#f-strings) allow to easily create strings that combine one or more variables with some hard-coded characters.\n",
    "\n",
    "The syntax is simply to:\n",
    "* Prefix the string with `f\"This is an f-string\".`\n",
    "* Inside an f-string, variable content can be accessed using curly braces, as in\n",
    "  `f\"This is a {variable_name}.\"`.  \n",
    "  Here, `{variable_name}` will expand to the content of the variable `variable_name`.\n",
    "\n",
    "**Examples:**\n",
    "\n",
    "```python\n",
    "# Example 1:\n",
    "first_name = \"Alice\"\n",
    "last_name = \"Smith\"\n",
    "\n",
    "full_name = f\"{first_name} {last_name}\"   # Same as: full_name = first_name + \" \" + last_name\"\n",
    "print(f\"Her full name is {full_name}.\")   # -> Her full name is Alice Smith.\n",
    "\n",
    "# Example 2:\n",
    "animal = \"cat\"\n",
    "container = \"bag\"\n",
    "\n",
    "print(f\"The {animal} is out of the {container}!\")  # -> The cat is out of the bag!\n",
    "```\n",
    "    \n",
    "</div>"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "### String slicing <a id='18'></a>\n",
    "\n",
    "Because strings are a type of sequence (a sequence of characters), the different characters of a string can be accessed using the **`[]` operator**, with the index of the desired element(s).  \n",
    "\n",
    "<img src=\"img/var_str3_with_indexes_and_access.png\" alt=\"representation of a string variable in memory with indexes and access to an element\" style=\"width:250px;\" />\n",
    "\n",
    "<br>\n",
    "\n",
    "* Remember that in python, **the index of the first element is `[0]`**.\n",
    "* Negative indices will access characters starting from the end of the string. E.g. `[-1]` returns the\n",
    "  last character in the string.\n",
    "  \n",
    "<img src=\"img/var_str3_with_indexes_and_reverse_access.png\" alt=\"representation of a string variable in memory with indexes and access to an element using reverse indexing\" style=\"width:400px;\" />\n",
    "  "
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_string = \"And now, something completely different.\"\n",
    "\n",
    "print(\"The first element of this string is:\", my_string[0] )  # 0 is the index of the 1st element of the string.\n",
    "print(\"The 5th element of this string is:\", my_string[4] )    # 5th element of the string.\n",
    "print(\"The last element of this string is:\", my_string[-1] )  # -1 is the index of the last element of the string."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "Indices can also be used to retrieve several elements at once: this is called a **slice operation** or **slicing**:\n",
    "* The general syntax of slicing is `[start index: end index (excluded): step]`\n",
    "* The end index position is **excluded from the slice**.\n",
    "* The **default step value is 1**. It can be omitted (and usually is).\n",
    "* If the start index is omitted, the slicing is implicitly done from the beginning of the string. `string[:10]`\n",
    "* If the end index is omitted, the slicing is implicitly done until the end of the string. `string[10:]`"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_string = \"And now, something completely different.\"\n",
    "\n",
    "print(my_string)\n",
    "print(my_string[0:5])   # Slice operation: get all elements from index 0 (included) to index 5 (excluded)\n",
    "print(my_string[:5])    # Implicitly slices from the beginning of the string up to (but not included) index 5.\n",
    "print(my_string[5:])    # Implicitly slices until the end of the string.\n",
    "print(my_string[5::2])  # Keep every second letter, starting from index 5 to the end of the string."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "**Tip:** you can reverse a sequence (such as a string) by using the **`[::-1]`** slicing operation."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "print(my_string[::-1])  # Goes through the string from end to start -> reverses the string !"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "<div class=\"alert alert-block alert-success\">\n",
    "\n",
    "### Micro Exercise 4 <a id='19'></a>\n",
    "* Create a string variable containing your name.\n",
    "* Extract the last 3 letters from it using slicing.\n",
    "\n",
    "</div>"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "## Lists and tuples <a id='20'></a>\n",
    "\n",
    "Lists are **sequence type** objects that can contain any type of elements (other objects).\n",
    "* **Lists** are declared by surrounding a comma separated list of objects with **`[]`**.  \n",
    "  Example: `[\"This\", \"is\", \"a list\", \"with\", 6, \"items\"]`\n",
    "\n",
    "<br>\n",
    "\n",
    "#### Creating a list"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Create a new list.\n",
    "my_list = [\"item 0\", \"item 1\", \"item 2\"]\n",
    "\n",
    "print(\"The content of my_list is:\", my_list)\n",
    "print(\"length of my list is:\", len(my_list))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Create a new list, here populated with integer numbers.\n",
    "another_list = [0, 1, 1, 2, 3, 5, 8, 13, 21, 34]\n",
    "\n",
    "print(\"\\nThe content of my_list is:\", another_list)\n",
    "print(\"length of my list is:\", len(another_list))"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "* List items can be of **heterogenous type**.\n",
    "* List **items can be of any type**: therefore it's possible to nest lists within other lists."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_list = [1, 2, \"spam\", \"eggs\", 5.2, [2, \"spam\"]]\n",
    "\n",
    "print(\"The content of my_list is:\", my_list)\n",
    "print(\"length of my list is:\", len(my_list))"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "#### Creating an empty list\n",
    "\n",
    "* Both `[]` and `list()` can be used create an empty list.  \n",
    "* Generally `[]` is considered the more *pythonic* way of creating empty lists."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "list_1 = []\n",
    "list_1 = list()\n",
    "\n",
    "print(\"Content:\", list_1, \" Type:\", type(list_1), \" Length:\", len(list_1))"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "#### Creating lists from iterables (e.g. sequences such as lists, tuples, or a range)\n",
    "\n",
    "* Objects that are *iterables* can be converted to lists using the `list()` function."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Creating a list from a \"range\" type object.\n",
    "list_1 = list(range(21))\n",
    "print(list_1)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "> What are **`range`** objects?  \n",
    "> `range` objects are sequences of **integer numbers**, e.g. `0, 1, 2, 3, 4, ...`.\n",
    ">\n",
    "> By default, a call to `range(x)` creates a sequence of integers from `0` to `x`, `x` excluded.\n",
    ">\n",
    "> **Examples**:\n",
    "> * `range(10)`    -> `0, 1, 2, 3, 4, 5, 6, 7, 8, 9`\n",
    "> * `range(3, 7)` -> `3, 4, 5, 6`"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "### Accessing values: list slicing <a id='21'></a>\n",
    "\n",
    "* Accessing an element (or a range of elements) in a list is done using the **`[]`** operator.\n",
    "* The **`[]` operator** works in much the same way than with strings, and allows\n",
    "  **accessing individual objects** from a list, or **slicing** it.\n",
    "\n",
    "<img src=\"img/var_list1.png\" alt=\"representation of a list variable in memory with indices\" style=\"width:250px;\" />\n",
    "\n",
    "* As with strings, remember that the **end position index is excluded** from the slicing."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_list = [1, 2, \"spam\", \"eggs\", 5.2, [2, \"spam\"]]\n",
    "\n",
    "print(my_list)\n",
    "print(my_list[0])   # Get the 1st item of the list.\n",
    "print(my_list[2:])  # Get all elements from index 2 (i.e. the 3rd element) to the end of the list."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "* If we try to access an index that does not exist in the list, an **`IndexError`** is raised.\n",
    "\n",
    "```py\n",
    "    my_list = [1, 2, \"spam\"]\n",
    "    my_list[3]\n",
    "\n",
    "    ---------------------------------------------------------------------------\n",
    "    IndexError                                Traceback (most recent call last)\n",
    "    Input In [26], in <module>\n",
    "          1 my_list = [1, 2, \"spam\"]\n",
    "    ----> 2 my_list[3]\n",
    "\n",
    "    IndexError: list index out of range\n",
    "```"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "### Tuples\n",
    "\n",
    "Tuples are very similar to lists in that they also are a **sequence type** objects that can contain any type of element (other objects).  \n",
    "* **Tuples** are declared using the syntax **`(value1, value2, ...)`**.\n",
    "* Values in **tuples** can be accessed and sliced in the same way as lists are.\n",
    "* The main difference between lists and tuples is that **the values in a tuple cannot be changed**\n",
    "  once the tuple has been created. This means that we cannot add/remove values from a tuple, nor can\n",
    "  we modify a value inside it."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "#### Create a tuple\n",
    " * **Important:** if a tuple contains a single element, then the last (and only) element of the tuple must be\n",
    "   followed by a comma.\n",
    " * If the tuple contains multiple elements, then this final comma is not necessary (but allowed).\n",
    "     ```py\n",
    "     a_tuple = (value, )`   # Correct syntax.\n",
    "     a_tuple = (value)      # This will NOT create a tuple, but a regular value.\n",
    "     ```"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Create a tuple of 3 elements.\n",
    "tuple_1 = (\"spam\", \"eggs\", \"coconuts\")\n",
    "\n",
    "print(tuple_1)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Create a tuple of 1 element.\n",
    "tuple_1 = (\"spam\", )\n",
    "\n",
    "print(\"Content of variable:\", tuple_1)\n",
    "print(\"Length of tuple is :\", len(tuple_1))\n",
    "print(\"type of variable   :\", type(tuple_1))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Create a tuple from a list.\n",
    "list_1 = [\"a\", \"sequence\", \"of\", \"strings\"]\n",
    "tuple_1 = tuple(list_1)\n",
    "\n",
    "print(tuple_1)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {
    "vscode": {
     "languageId": "python"
    }
   },
   "source": [
    "<br>\n",
    "\n",
    "**Warning:** the following does not create a tuple, but a variable of type string!"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "tuple_1 = (\"spam\")\n",
    "print(\"Content of variable:\", tuple_1)\n",
    "print(\"Length of variable :\", len(tuple_1))\n",
    "print(\"type of variable   :\", type(tuple_1))"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "#### Creating empty tuples\n",
    "* Empty tuples can be created with `()` or `tuple()`.\n",
    "* Note that because tuples cannot be changed after they are created, it is not possible to add elements\n",
    "  to an empty tuple."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "tuple_1 = ()\n",
    "tuple_1 = tuple()\n",
    "\n",
    "print(\"Content:\", tuple_1, \" Type:\", type(tuple_1), \" Length:\", len(tuple_1))"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "### When to use `list` or `tuple`? Mutability - an important difference between lists and tuples <a id='22'></a>\n",
    "\n",
    "* A `list` is **mutable**: it can be extended, reduced, and its elements can be changed.\n",
    "* A `tuple` is **immutable**: its length is fixed and its elements cannot be changed.\n",
    "\n",
    "<br>\n",
    "\n",
    "**Use tuples** when:\n",
    "  * You need to store a sequence of objects that will not change in your program (fixed length).\n",
    "  * You want to be sure that a sequence of objects will not be accidentally modified - a\n",
    "    sort of **write-protection**.\n",
    "  * Tuples are slightly more memory efficient than list.\n",
    "      ```py\n",
    "        import sys\n",
    "        print(sys.getsizeof((1, 2, 3, 4, 5)))  # -> 80 bytes\n",
    "        print(sys.getsizeof([1, 2, 3, 4, 5]))  # -> 96 bytes.\n",
    "      ```\n",
    "\n",
    "<br>\n",
    "\n",
    "**Use lists** when:\n",
    "  * You need to store a sequence of objects that will be modified over time.\n",
    "  * You need to have a sequence that can be grown (add elements) or shrunk (remove elements).\n",
    "\n",
    "<br>\n",
    "\n",
    "For more details about object mutability in python, see the **Additional Theory** section at the end of this notebook.\n",
    "\n",
    "<br>\n",
    "\n",
    "**Example:** because lists are mutable, we can modify an element in a list (or add/remove an element from a list)."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Create a new list.\n",
    "sandwich_ingredients = [\"spam\", \"ham\", 3, \"eggs\"]\n",
    "\n",
    "# We now modify the 4th element of the list:\n",
    "sandwich_ingredients[3] = \"and spam\"\n",
    "\n",
    "print(sandwich_ingredients)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {
    "scrolled": true,
    "vscode": {
     "languageId": "python"
    }
   },
   "source": [
    "Trying to do the same modification on a tuple raises a **`TypeError`**:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "scrolled": true
   },
   "outputs": [],
   "source": [
    "sandwich_ingredients = (\"spam\", \"ham\", 3, \"eggs\")\n",
    "sandwich_ingredients[3] = \"and spam\""
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "What can be done however, is to **assign a new tuple to the same variable** - this will *look* like we have modified a tuple, but in fact we have created a new tuple object and assigned it to our variable."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "sandwich_ingredients = (\"spam\", \"ham\", 3, \"eggs\")\n",
    "print(sandwich_ingredients)\n",
    "\n",
    "# We do not modify an existing tuple: we create a new one.\n",
    "sandwich_ingredients = (\"spam\", \"ham\", 3, \"and spam\")\n",
    "print(sandwich_ingredients)\n"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "### Additional info: tuples referencing mutable values\n",
    "\n",
    "* We just saw that **tuples are immutable**... but let's consider the following:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_tuple = (\"a\", \"b\", [1, 2, 3])\n",
    "print(\"The tuple looks like this:\", my_tuple)\n",
    "\n",
    "my_tuple[2][2] = \"Did I just change an immutable tuple?\"\n",
    "print(\"The tuple looks like this:\", my_tuple)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "In the above, it *looks* like we have modified a tuple! But in fact, we have only modified a list that happens\n",
    "to be referenced by the tuple.\n",
    "\n",
    "Nested lists or tuples can be visualized like this:\n",
    "\n",
    "<img src=\"img/var_list_nested.png\" alt=\"representation of a nested list variable in memory\" style=\"width:450px;\" />\n",
    "\n",
    "* So `my_list` does not really contains the list and string themselves, but only a **pointer to these objects**.\n",
    "* Changing the content of a list does not change its pointer, and therefore in the code example above\n",
    "  the tuple has in fact not been modified: it is still pointing at the same list. The same behavior\n",
    "  happens if we store a dictionary in a tuple.\n",
    "\n",
    "* This behavior can be visualized using this [interactive code visualizer](https://pythontutor.com/render.html#code=my_tuple%20%3D%20%28%22a%22,%20%22b%22,%20%5B1,%202,%203%5D%29%0Aprint%28%22The%20tuple%20looks%20like%20this%3A%22,%20my_tuple%29%0A%0Amy_tuple%5B2%5D%5B2%5D%20%3D%20%22did%20I%20just%20change%20an%20immutable%20tuple%3F%22%0Aprint%28%22The%20tuple%20looks%20like%20this%3A%22,%20my_tuple%29&cumulative=false&curInstr=0&heapPrimitives=nevernest&mode=display&origin=opt-frontend.js&py=3&rawInputLstJSON=%5B%5D&textReferences=false)\n",
    "\n",
    "<br>\n",
    "\n",
    "For reference, accessing the nested elements looks like this:\n",
    "\n",
    "<img src=\"img/var_list_nested_access.png\" alt=\"representation of a nested list variable in memory with access\" style=\"width:450px;\" />"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "### Copy of list content vs. copy of pointer (copying mutable values)\n",
    "\n",
    "When assigning a variable to another variable (as done below when assigning `l1` to `l2`), we are not duplicating the content of the existing variable: instead, we only create **a new pointer** to the content of the original variable.\n",
    "* The example below can also be visualized on [the interactive code visualizer](https://pythontutor.com/render.html#code=l1%20%3D%20%5B1,%202,%203%5D%0Al2%20%3D%20l1%0Al2%5B0%5D%20%3D%20-1%0A%0Aprint%28%22l2%20is%3A%22,%20l2%29%0Aprint%28%22l1%20is%3A%22,%20l1%29%0A%0Adel%20l1%0Adel%20l2%0A%0Al1%20%3D%20%5B1,%202,%203%5D%0Al2%20%3D%20l1.copy%28%29%0Al2%5B0%5D%20%3D%20-1%0A%0Aprint%28%22l2%20is%3A%22,%20l2%29%0Aprint%28%22l1%20is%3A%22,%20l1%29&cumulative=false&curInstr=0&heapPrimitives=nevernest&mode=display&origin=opt-frontend.js&py=3&rawInputLstJSON=%5B%5D&textReferences=false)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "l1 = [1, 2, 3]\n",
    "l2 = l1\n",
    "print(\"The content of list 1:\", l1)\n",
    "print(\"The content of list 2:\", l2)\n",
    "\n",
    "# By modifying the underlying list to which both l1 and l2 are pointing, both l1 and l2\n",
    "# return the modified value.\n",
    "l2[0] = -1\n",
    "print(\"The content of list 1:\", l1)\n",
    "print(\"The content of list 2:\", l2)\n",
    "\n",
    "print(\"\\nAre both list pointing to the same memory location?\", l1 is l2)\n",
    "print(\"Memory locations of the 2 lists:\", id(l1), id(l2), sep=\"\\n\")"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "To make a copy of the actual list content, we must use the **`copy()`** method of list."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "l1 = [1, 2, 3]\n",
    "l2 = l1.copy()\n",
    "print(l1)\n",
    "print(l2)\n",
    "\n",
    "# Now l1 and l2 are pointing to different memory locations.\n",
    "l2[0] = -1\n",
    "print(l1)\n",
    "print(l2)\n",
    "\n",
    "print(\"\\nAre both list pointing to the same memory location?\", l1 is l2)\n",
    "print(\"Memory locations of the 2 lists:\", id(l1), id(l2), sep=\"\\n\")"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "### Manipulating lists: adding and removing elements <a id='23'></a>\n",
    "\n",
    "Remember the `help()` function ? Let's use it to gain a better understanding of the `list` type:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "help(list)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "That's a lot of information... let's go through it!  \n",
    "* First we learn that `list` is a class (i.e. a specific type of object).\n",
    "  Calling `list()` can thus create instances (instantiate objects) of type `list`.\n",
    "* The help page then tells us that lists are:\n",
    "  \n",
    "  > built-in mutable sequence\n",
    "   \n",
    "  and describes the behavior of `list()` if no argument is given (creates an empty list).\n",
    "  <br>\n",
    "  \n",
    "* The help lists all methods available for class `list`, under `Methods defined here:`:\n",
    "    * **Methods** are functions that can be called on objects of the class they belong to.\n",
    "      This often enable some basic manipulation of objects of that type.  \n",
    "    * Methods are called using the syntax **`object.method(...)`**.\n",
    "    * Methods that start with **`__`** are **private methods**. They are not meant to be directly called\n",
    "      by the end user.\n",
    "      \n",
    "      > *Note:* the double underscore **`__`** is called a **dunder**.\n",
    "      \n",
    "    * The **`/` symbol** found in some method signatures indicates that **all arguments present before the `/`\n",
    "      are positional arguments, even if they have a default value**. They have to be passed in the correct\n",
    "      order, and cannot be passed with their argument name, i.e. `argument_name=value` - \n",
    "      [more details here](https://www.python.org/dev/peps/pep-0570).\n",
    "    * The **`*` symbol** found in some method signatures indicates that **all arguments after the `*` are\n",
    "      keyword arguments only**. In other words, no positional arguments are allowed after the `*`, and all\n",
    "      arguments passer after the `*` must always be passed as `argument_name=value` -\n",
    "      [more details here](https://peps.python.org/pep-3102)\n",
    "\n",
    "Let's focus on 3 methods of the `list` class:\n",
    " * **`append(self, object, /)`**: this method adds an object - given as argument - at the end of the list.\n",
    " * **`extend(self, iterable, /)`**: this method concatenates (extends) the list with the items from the iterable \n",
    "    passed as argument.\n",
    " * **`insert(self, index, object, /)`**: this method inserts an object - given as the 2nd argument - before \n",
    "   the index given as the 1st argument.\n",
    "\n",
    "<br>\n",
    "\n",
    "**Example 1:** appending a single element."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_list = [1 , 2 , 5]\n",
    "print(\"Initially, my list is:\\n\", my_list)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "* Calling the `.append()` method of a list (here `my_list`) adds the specified element at the end of the list:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_list.append(\"ham\") \n",
    "print(\"The list, after appending 'ham' is now:\\n\", my_list)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_list.append(\"eggs\")\n",
    "print(my_list)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "* Trying to add a string to a list with **`.extend()`** can lead to unexpected results."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_list.extend(\"eggs\")\n",
    "print(my_list)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "* *Note:* to add a string with `.extend()`, it has to be an element of an iterable (list, tuple, etc)."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_list = [1 , 2 , 3]\n",
    "my_list.extend((\"eggs\",))\n",
    "print(my_list)\n",
    "\n",
    "my_list.extend([\"eggs again\"])\n",
    "print(my_list)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "**Example 2:** adding multiple values to a list - `append()` vs. `extend()` vs. concatenation.\n",
    "* **`append(value)`** adds the specified value at the end of the list as a single value.\n",
    "* When trying to add multiple values to a list, it might not have the desired effect."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_list = [1, 2, 3]\n",
    "my_list.append([\"spam\", \"eggs\"])\n",
    "\n",
    "print(my_list)\n",
    "print(\"List length:\", len(my_list), \"\\n\")"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "* **`extend(iterable)`** add the values given in the specified **iterable** (e.g. a list, tuple, generator) to\n",
    "  the list."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_list = [1, 2, 3]\n",
    "my_list.extend([\"spam\", \"eggs\"])\n",
    "\n",
    "print(my_list)\n",
    "print(\"List length:\", len(my_list), \"\\n\")"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "* **List concatenation** with the `+` operator has the same effect as `extend()`."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_list = [1, 2, 3]\n",
    "my_list += [\"spam\", \"eggs\"]   # This is the same as: my_list = my_list + [\"spam\", \"eggs\"]\n",
    "\n",
    "print(my_list)\n",
    "print(\"List length:\", len(my_list), \"\\n\")"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {
    "vscode": {
     "languageId": "python"
    }
   },
   "source": [
    "#### `insert()` method\n",
    "\n",
    "* Adding en element at a **specific position in the list** can be done with the **`insert()`** method.\n",
    "* In this example, we add an element in second position of `my_list`.\n",
    "* Remember that Python indices start with 0, so inserting before position 1 puts \n",
    "  the new object in second position in `my_list` (and not in the first)."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_list = [1, 2, 3]\n",
    "my_list.insert(1 , \"beans\") \n",
    "print(\"list after insert:\", my_list)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "### Deleting elements in a list\n",
    "\n",
    "* `list_object.pop(x)`: **deletes** the element at position `x` **and returns it**.\n",
    "  If no arguments are passed to `pop()`, the last element of the list is removed by default.\n",
    "* `del list_object[]`: **deletes** a single element or a slice.\n",
    "\n",
    "*Note:* using the `.pop()` method is generally considered to be more *pythonic* than using `del`.\n",
    "\n",
    "**Example:** deleting with `del`:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "a_list = list(range(21))\n",
    "print(\"Original list:\\n\", a_list, \"\\n\")\n",
    "\n",
    "# Delete the last element from the list.\n",
    "del a_list[-1]\n",
    "print(\"Deleted the last element:\\n\", a_list, \"\\n\")\n",
    "\n",
    "# Delete all elements in positions 0 to 9. The element in position 10 is not deleted.\n",
    "del a_list[0:10]\n",
    "print(\"Deleted elements 0-9:\\n\", a_list)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "**Example:** deleting an item with the `pop()` method:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "a_list = list(range(21))\n",
    "print(\"Original list:\\n\", a_list, \"\\n\")\n",
    "\n",
    "# By default, the last element of the list is removed by pop().\n",
    "removed = a_list.pop()\n",
    "print(\"Removed the last element:\\n\", a_list)\n",
    "print(\"The element removed by pop is:\", removed, end=\"\\n\\n\")\n",
    "\n",
    "# To remove an element at a specific index, the index value must be passed to the .pop() method:\n",
    "removed = a_list.pop(0)\n",
    "print(\"Removed the first element:\\n\", a_list)\n",
    "print(\"The element removed by pop is:\", removed)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "### From list to string, and back again ... <a id='24'></a>\n",
    "Since string variable are **iterables** (they are sequences of characters), they can be converted to a list of characters using the **`list()`** function:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "quote = \"Drop your panties Sir William, I cannot wait till lunchtime.\"\n",
    "individual_chars = list(quote)\n",
    "\n",
    "print(individual_chars)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "As can be seen above, the default behavior is that **each letter of the string becomes an element in the list**.\n",
    "\n",
    "However, often we prefer to create a list that contains each word of the string. For this we use the **`split()`** method of string:\n",
    "* The `split()` method is very useful when reading formatted text files.\n",
    "* By default, it splits on white space (i.e. spaces, tabs, newlines).\n",
    "* It accepts an optional `sep` argument that allows separation of fields using the specified character (look up `help(str.split)` for details)."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "quote = \"Drop your panties Sir William, I cannot wait till lunchtime.\"\n",
    "words = quote.split()\n",
    "\n",
    "print(words)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "**To convert a list to a string**, the **`join()`** method can be used - it can be seen as the inverse of `split()`.  \n",
    "Somehow counter-intuitively, the `join()` method applies to strings, and takes a list as argument:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Here, the separator calls the join method which accepts the list \"my_list\" as argument.\n",
    "quote = \" \".join(words) \n",
    "print(quote)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# One can use a more exotic separator - in fact, any string can be used as separator.\n",
    "quote = \"_SEP_\".join(words) \n",
    "print(quote)\n",
    "\n",
    "# TIP: use an empty separator to join characters into a string.\n",
    "a_string = \"\".join(['to','ba','c','co','ni','st']) \n",
    "print(a_string)\n",
    "print(type(a_string))"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "**Tip**: lists can be concatenated with the `+` operator, extended with `+=` (addition assignment) and \"multiplied\" with `*`:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Create a new list by appending two lists.\n",
    "list_one = [ \"hello\" , 1159 ]\n",
    "list_two = list_one + [10.1, \"45\", 7]\n",
    "print(list_one)\n",
    "print(list_two)\n",
    "\n",
    "# Extend a list with the += operator.\n",
    "list_one += [\"spam\", \"eggs\"] \n",
    "print(list_one)\n",
    "\n",
    "# As well as multiplication\n",
    "menu = [\"spam\", \"eggs\"] * 3 \n",
    "print(menu)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "<div class=\"alert alert-block alert-success\">\n",
    "\n",
    "### Micro Exercise 5 <a id='25'></a>\n",
    "* Create a list with all integers from 0 to 3 in it.\n",
    "* Add two numbers at the end of the list.\n",
    "* Use a slicing operation to select the fourth element in the list.\n",
    "\n",
    "* **If you have the time:**\n",
    "    * What is the difference between `list.pop()` and `list.remove()`?  \n",
    "      Try to find-out empirically using the list `[6, 5, 5, 4, 3, 2, 1]` and\n",
    "      running `.pop(5)` and `.remove(5)` on the list.\n",
    "    * Why does `print(my_list.append(\"something\"))` print \"None\"?\n",
    "\n",
    "<div>"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "<br>\n",
    "<br>\n",
    "\n",
    "### Returning a value vs. in-place modification\n",
    "\n",
    "As you might have noticed, methods do sometimes return a value, and sometimes modify an object \"inplace\", meaning that the object on which the method is called is itself modified.\n",
    "\n",
    "**Example:** the `.upper()` method of a string object returns a value. It does not modify the original string."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "a_quote = \"You must cut down the mightiest tree in the forest with a herring!\"\n",
    "return_value = a_quote.upper()\n",
    "\n",
    "print(\"The return value is:\", return_value)\n",
    "print(\"The original object:\", a_quote)        # The original object has not been changed."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "**Example:** The `.append()` method of a list **modifies the list inplace**, and returns the value `None`.\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "scrolled": true
   },
   "outputs": [],
   "source": [
    "more_quotes = [\n",
    "    \"What… is your quest?\",\n",
    "    \"To seek the Holy Grail\",\n",
    "]\n",
    "return_value = more_quotes.append(\"Well, how did you become king then?\")\n",
    "\n",
    "print(\"The return value is:\", return_value)\n",
    "print(\"The original object:\", more_quotes)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "When calling a method that modifies the object inplace and returns `None`, we generally do not store the return value in a variable.  \n",
    "Appending a value to a list would thus be written as:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "more_quotes.append(\"Well, how did you become king then?\")"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "## Dictionaries <a id='26'></a>\n",
    "Dictionaries, or `dict`, are containers that associate a **key** to a **value**, just like a real world dictionary associates a word to its definition.\n",
    "* Dictionaries are instantiated with the `{key:value}` or `dict(key=value)` syntax.\n",
    "\n",
    "    ```python\n",
    "    color_code = {'blue': 23, 'green': 45, 'red': 8}\n",
    "    ```\n",
    "  \n",
    "* **Keys** must be unique in the dictionary, and must be an immutable object (typically a `str`).\n",
    "* **Values** can appear as many time as desired in the dictionary.\n",
    "* The `[]` operator is used to **select objects from the dictionary**, but **using their key** instead\n",
    "  of their index. E.g. `color_code[0]` is not a valid syntax (and will raise a **`KeyError`**), unless\n",
    "  there is a key value of `0` in the dict (which is not the case in our example).\n",
    "  \n",
    "    ```python\n",
    "    color_code['blue']   # returns 23\n",
    "    color_code['red']    # returns 8\n",
    "    ``` \n",
    "* Dictionaries are **mutable** objects: `key:value` pairs can be added and removed, values can be modified."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {
    "vscode": {
     "languageId": "python"
    }
   },
   "source": [
    "**Examples:**\n",
    "\n",
    "* **Create a dictionary with values** in it."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "student_age = {\n",
    "    \"Anne\": 26 , \n",
    "    \"Victor\": 31,\n",
    "}\n",
    "\n",
    "# Alternatively:\n",
    "student_age = dict(Anne=26, Victor=31)\n",
    "\n",
    "print(student_age)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "* **Retrieve values** associated with keys."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "print(\"The age of Anne is  :\", student_age[\"Anne\"])\n",
    "print(\"The age of Victor is:\", student_age[\"Victor\"])"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "* **Trying to access an element of the `dict` by index is not possible**. It raises a **`KeyError`**, because\n",
    "  python is trying to find the key `0` in the dictionary and it does not exist."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Trying to access an element of the dict by index -> KeyError\n",
    "student_age[0]"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "* **Adding additional `key:value` pairs** to a dictionary, or modifying an existing key is as easy as:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "student_age[\"Eleonore\"] = 5\n",
    "print(student_age)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "* **Modifying an existing key** of a dictionary."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "student_age[\"Eleonore\"] = 25\n",
    "print(student_age)\n",
    "\n",
    "student_age[\"Eleonore\"] += 1  # Shortcut for: student_age[\"Eleonore\"] = student_age[\"Eleonore\"] + 1\n",
    "print(student_age)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {
    "vscode": {
     "languageId": "python"
    }
   },
   "source": [
    "<br>\n",
    "\n",
    "* **Create an empty dictionary**, then **add values** to it.\n",
    "  * Empty dictionaries can be created with either **`{}`** or **`dict()`**.\n",
    "    Using `{}` is considered more *pythonic*.\n",
    "  * To **add a value to a `dict`**, we simply specify a new key value."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Create an empty dict.\n",
    "student_age = dict()\n",
    "student_age = {}\n",
    "print(student_age)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "scrolled": true
   },
   "outputs": [],
   "source": [
    "# Add new key:value pairs to the dict.\n",
    "student_age[\"Anne\"] = 26\n",
    "print(student_age)\n",
    "\n",
    "student_age[\"Victor\"] = 31\n",
    "print(student_age)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "We are not restricted to a particular type for keys, nor for values. We can e.g. make a `dict` of lists or `dict` of `dict`.\n",
    "* In practice, it's best to use dictionaries for storing **homogenous values** (i.e. you probably don't want\n",
    "  to store unrelated things in different keys)."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "student_age[0] = \"zero\"                             # Key is an integer number.\n",
    "student_age[\"group_1\"] = [23, 25, 28]               # Value is a list.\n",
    "student_age[\"group_2\"] = {\"bob\": 26, \"alice\": 27}   # Value is a dict.\n",
    "\n",
    "print(student_age)\n",
    "print(\"Bob's age is:\", student_age[\"group_2\"][\"bob\"])"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "* Mutable values **cannot be used as keys!**"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Not allowed to use `[1,2]` as a key of the dict, because a list is a mutable object.\n",
    "student_age[[1,2]] = \"shrubbery\""
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "### Removing items from a dictionary\n",
    "Removing an item from a dictionary is similar as deleting items from a list:\n",
    " * **`dict.pop(key)`**: deletes the specified `key` from the dictionary and returns its value.\n",
    " * **`del dict[key]`**: deletes the specified `key` (and its associated value) from the dictionary."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Create a new dictionary.\n",
    "student_age = {\n",
    "    \"Anne\": 26,\n",
    "    \"Victor\": 31,\n",
    "    \"Eleonore\": 25,\n",
    "}\n",
    "print('dictionary:', student_age)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Delete values from the dictionary.\n",
    "del student_age[\"Victor\"]\n",
    "removed_value = student_age.pop(\"Anne\")\n",
    "\n",
    "print('dictionary:', student_age)\n",
    "print(\"\\nThe value we removed with 'pop' is:\", removed_value)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "<br>\n",
    "\n",
    "## Exercises 1.1 - 1.5 <a id='27'></a>\n",
    "--------------------------\n",
    "\n",
    "* Exercises are found in a separate Jupyter Notebook.\n",
    "* If you have time, feel free to try the **additional exercises**.\n",
    "\n",
    "<br>\n",
    "<br>\n",
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "<div class=\"alert alert-block alert-info\">\n",
    "\n",
    "# Additional Material <a id='28'></a>\n",
    "-------------------------------------\n",
    "\n",
    "</div>\n",
    "\n",
    "<br>\n",
    "\n",
    "### Mutability of objects in Python <a id='29'></a>\n",
    "\n",
    "All objects in Python can be either **mutable** or **immutable**. This is an important notion that newcomers to Python need to be aware of, which otherwise can lead to serious bugs in our codes.\n",
    "\n",
    "What do we mean by *mutable*? We learnt earlier that **everything in Python is an object** and every variable holds an instance of an object. Once its type is set at runtime it can never change. A list is always a list, an integer is always an integer. However its value can be modified if it is mutable.\n",
    "\n",
    "A mutable object can be changed/modified after it is created, and an immutable object can’t."
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "| Class   | Mutable |\n",
    "| ------- |:-------:|\n",
    "| `bool`  | no |\n",
    "| `int`   | no |\n",
    "| `float` | no |\n",
    "| `str`   | no |\n",
    "| `list`  | yes |\n",
    "| `tuple` | no |\n",
    "| `dict`  | yes |"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Mutability has not much practical importance for simple types, but it has for container types.  \n",
    "Let's see this with some examples:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "a_str = \"Python\"\n",
    "a_list = [\"P\", \"y\", \"t\", \"h\", \"o\", \"n\"]\n",
    "a_tuple = (\"P\", \"y\", \"t\", \"h\", \"o\", \"n\")\n",
    "a_dict = {0: \"P\", 1: \"y\", 2: \"t\", 3: \"h\", 4: \"o\", 5: \"n\"}"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Let's try to modify an element (an individual char) in a string: it raises a **`TypeError`** because a string in an **immutable type**."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Let's try to change \"P\" into \"p\"\n",
    "print(a_str[0])\n",
    "a_str[0] = \"p\""
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {
    "vscode": {
     "languageId": "python"
    }
   },
   "source": [
    "Let's try to modify an element in a list: this is possible, because a list is a **mutable type**."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "print(a_list)\n",
    "a_list[0] = \"p\"\n",
    "print(a_list)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {
    "vscode": {
     "languageId": "python"
    }
   },
   "source": [
    "However, the *immutable* cousin of `list`, the `tuple`, does not allow assignment:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "print(a_tuple[0])\n",
    "a_tuple[0] = \"p\""
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "Dictionaries are mutable, their values can be modified:"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "print(a_dict)\n",
    "a_dict[0] = \"p\"\n",
    "print(a_dict)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_dict = {\"str\": a_str, \"list\": a_list}\n",
    "another_dict = my_dict\n",
    "print(another_dict[\"list\"])"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Let's now modify my_dict...\n",
    "my_dict[\"list\"][0] = \"P\"\n",
    "\n",
    "# ... and see what happens to both dictionaries.\n",
    "print(\"my_dict:\", my_dict)\n",
    "print(\"another_dict:\", another_dict)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Although we never changed/modified `another_dict`, it was also changed. This is because the key **'list'** in both dictionaries refer to the same `list` object: `a_list`. It is mutable and once it is modified, both dictionaries will reflect this modification. Let's visit this with a final example."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "a_list[0] = \"Z\"\n",
    "print(\"my_dict:\", my_dict)\n",
    "print(\"another_dict:\", another_dict)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "**To summarize:**\n",
    "\n",
    "* An object in Python can either be mutable or immutable.\n",
    "* We can simply check it by trying to modify a variable.\n",
    "* `str` and `tuple` are immutable\n",
    "* `list` and `dict` are mutable\n",
    "* We need to pay attention when we modify mutable objects that are referred from multiple variables!"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_dict[\"str\"] = \"Zython\"\n",
    "\n",
    "print(\"my_dict:\", my_dict)\n",
    "print(\"another_dict:\", another_dict)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "a_third_dict = my_dict.copy()\n",
    "my_dict[\"str\"] = \"Kython\"\n",
    "my_dict[\"list\"][0] = \"K\"\n",
    "\n",
    "print(\"my_dict:\", my_dict)\n",
    "print(\"third_dict:\", a_third_dict)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "[Back to ToC](#toc)\n",
    "\n",
    "### A solution: explicit deep copy <a id='30'></a>\n",
    "\n",
    "The difference between shallow and deep copying is only relevant for compound objects (objects that contain other objects, like lists, dicts, or class instances):\n",
    "\n",
    "* A **shallow copy** constructs a new compound object and then (to the extent possible) inserts references into\n",
    "  it to the objects found in the original.\n",
    "* A **deep copy** constructs a new compound object and then, recursively, inserts copies into it of the objects found\n",
    "  in the original."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "import copy\n",
    "\n",
    "a_third_dict = copy.deepcopy(my_dict)   # <- explicit deep copy\n",
    "my_dict[\"str\"] = \"Back to Python\"\n",
    "my_dict[\"list\"][0] = \"P\"\n",
    "print(\"my_dict:\", my_dict)\n",
    "print(\"another_dict:\", a_third_dict)"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### Copying immutable values\n",
    "\n",
    "* When making a copy of a variable of an immutable type (e.g. `str`, `int`, `float`, `tuple`, ...),\n",
    "  the copy will point to the same memory location.\n",
    "* However, when the variable value is changed (i.e. it is re-assigned a new value), then it will point to\n",
    "  a different memory location. This is expected, since immutable variable types cannot have their value\n",
    "  modified.\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "a = 3\n",
    "b = a\n",
    "print(\"Are 'a' and 'b' pointing to the same object in memory:\", a is b)\n",
    "print(\"Memory locations of the 2 objects:\", id(a), id(b), sep=\"\\n\")\n",
    "b += 1\n",
    "print(\"After having modified 'b':\")\n",
    "print(\"Are 'a' and 'b' pointing to the same object in memory:\", a is b)\n",
    "print(\"Memory locations of the 2 objects:\", id(a), id(b), sep=\"\\n\", end=\"\\n\\n\")"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "#### Python memory management: interned vs non-interned values\n",
    "\n",
    "> Integer values from -5 to 256 are **\"interned\"**, which means that they are created once\n",
    "> and then re-used over the entire runtime of the python program/session.\n",
    "\n",
    "```py\n",
    "    a = 256\n",
    "    b = 256\n",
    "    print(\"Are 'a' and 'b' pointing to the same object in memory?:\", a is b)\n",
    "    print(\"Memory locations of the 2 objects:\", id(a), id(b), sep=\"\\n\", end=\"\\n\\n\")\n",
    "```\n",
    "```text\n",
    "    Are 'a' and 'b' pointing to the same object in memory?: True\n",
    "    Memory locations of the 2 objects:\n",
    "    9801248\n",
    "    9801248\n",
    "```\n",
    "\n",
    "> The integer value of 257 on the other hand, is not \"interned\": this means that if the\n",
    "> value 257 is assigned independently to two different variables, they will not point\n",
    "> to the same memory location. The value if 257 is thus duplicated in memory.\n",
    "```py\n",
    "    a = 257\n",
    "    b = 257\n",
    "    print(\"Are 'a' and 'b' pointing to the same object in memory:\", a is b)\n",
    "    print(\"memory locations of the 2 objects:\", id(a), id(b), sep=\"\\n\", end=\"\\n\\n\")\n",
    "```\n",
    "```text\n",
    "    Are 'a' and 'b' pointing to the same object in memory: False\n",
    "    memory locations of the 2 objects:\n",
    "    139648697282640\n",
    "    139648697282736\n",
    "```\n",
    "\n",
    "> Literal strings are also \"interned\": when a variable is assigned a literal\n",
    "> string, python will first check whether such a string already exists somewhere\n",
    "> in memory, and if yes, the variable is pointed to the already existing string\n",
    "> in memory.\n",
    "```py\n",
    "    a = \"shrubbery\"\n",
    "    b = \"shrubbery\"\n",
    "    print(\"Are 'a' and 'b' pointing to the same object in memory:\", a is b)\n",
    "    print(\"memory locations of the 2 objects:\", id(a), id(b), sep=\"\\n\", end=\"\\n\\n\")\n",
    "```\n",
    "```text\n",
    "    Are 'a' and 'b' pointing to the same object in memory: True\n",
    "    memory locations of the 2 objects:\n",
    "    139649051058800\n",
    "    139649051058800\n",
    "```\n",
    "\n",
    "> Non-literal strings on the other hand are not interned:\n",
    "```py\n",
    "    a = str(23)\n",
    "    b = str(23)\n",
    "    print(\"Are 'a' and 'b' pointing to the same object in memory:\", a is b)\n",
    "    print(\"memory locations of the 2 objects:\", id(a), id(b), sep=\"\\n\", end=\"\\n\\n\")\n",
    "```\n",
    "```text\n",
    "    Are 'a' and 'b' pointing to the same object in memory: False\n",
    "    memory locations of the 2 objects:\n",
    "    139649050161200\n",
    "    139649050161968\n",
    "```\n",
    "\n",
    "> Because at this point the string \"shrubbery\" has already been created once before,\n",
    "> re-assigning it to another variable will still point to the same memory location as\n",
    "> it did earlier when it was assigned to \"a\" and \"b\".\n",
    "```py\n",
    "    c = \"shrubbery\"\n",
    "    print(\"memory locations of 'c' is:\", id(c), end=\"\\n\\n\")\n",
    "```\n",
    "```text\n",
    "    memory locations of 'c' is: 139649051058800\n",
    "```"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "<br>\n",
    "\n",
    "### Benchmarking: looping speed of tuples vs lists\n",
    "* As can be tested below, there is no speed difference between `lists` and `tuples`.\n",
    "* Generators are faster (probably because they skip the step where elements of the sequence must\n",
    "  be stored in memory)."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Functions that do nothing but loop through a list, tuple or generator.\n",
    "\n",
    "loop_replicates = 1000000\n",
    "\n",
    "def loop_range():\n",
    "    for x in range(loop_replicates):\n",
    "        pass\n",
    "\n",
    "def loop_tuple():\n",
    "    for x in tuple(range(loop_replicates)):\n",
    "        pass\n",
    "\n",
    "def loop_list():\n",
    "    for x in list(range(loop_replicates)):\n",
    "        pass\n",
    "\n",
    "# Compare the speed between tuples, lists and generators.\n",
    "%timeit loop_tuple()\n",
    "%timeit loop_list()\n",
    "%timeit loop_range()"
   ]
  }
 ],
 "metadata": {
  "kernelspec": {
   "display_name": "Python 3 (ipykernel)",
   "language": "python",
   "name": "python3"
  },
  "language_info": {
   "codemirror_mode": {
    "name": "ipython",
    "version": 3
   },
   "file_extension": ".py",
   "mimetype": "text/x-python",
   "name": "python",
   "nbconvert_exporter": "python",
   "pygments_lexer": "ipython3",
   "version": "3.12.2"
  }
 },
 "nbformat": 4,
 "nbformat_minor": 4
}