From a2eb9f1a788e03168a08810c45a6e242a18ca15c Mon Sep 17 00:00:00 2001 From: Nokome Bentley Date: Wed, 12 Feb 2020 13:09:30 +1300 Subject: [PATCH] fix(Demo): Generate examples standalone To avoid conflicts and confusion when example HTML has existing themes CSS and JS --- package.json | 2 +- src/demo/index.ts | 2 +- src/demo/styles.css | 4 +- src/examples/article-antibodies.html | 8003 +++++++++--------- src/examples/article-drosophila.html | 10171 +++++++++++------------ src/examples/article-kitchen-sink.html | 917 +- src/examples/generate.sh | 12 +- src/examples/index.ts | 6 +- src/index.html | 2 + 9 files changed, 9444 insertions(+), 9675 deletions(-) diff --git a/package.json b/package.json index 0ab565f41..3e90b4b14 100644 --- a/package.json +++ b/package.json @@ -19,7 +19,7 @@ "postinstall": "npm run build:selectors", "semantic-release": "semantic-release", "test": "npm run test:build && npm run test:run", - "test:build": "parcel build ./src/examples/article-kitchen-sink.html -d test/build --public-url .", + "test:build": "parcel build ./src/index.html ./src/examples/*.html -d test/build --public-url .", "test:run": "SAUCE_API_HOST=eu-central-1.saucelabs.com wdio", "watch": "parcel watch ./src/**/*.css ./src/**/*.ts" }, diff --git a/src/demo/index.ts b/src/demo/index.ts index 48dbea73c..f42e5cd5b 100644 --- a/src/demo/index.ts +++ b/src/demo/index.ts @@ -49,7 +49,7 @@ const exampleSet = async (example: string): Promise => { // Load the HTML content const req = new XMLHttpRequest() - req.open('GET', `./${examples[example]}`, false) + req.open('GET', examples[example], false) req.send(null) const html = req.responseText diff --git a/src/demo/styles.css b/src/demo/styles.css index 169faddab..59c016f00 100644 --- a/src/demo/styles.css +++ b/src/demo/styles.css @@ -36,10 +36,10 @@ header { .github { img { - margin-left: 1rem; + margin: 0 0.5rem; height: 24px; width: 24px; - color: #777; + opacity: 0.4; } } } diff --git a/src/examples/article-antibodies.html b/src/examples/article-antibodies.html index 79f6bb3b1..4460bc312 100644 --- a/src/examples/article-antibodies.html +++ b/src/examples/article-antibodies.html @@ -1,4056 +1,3975 @@ - - - - Optimizing antibody affinity and stability by the automated design of the variable - light-heavy chain interfaces - - - - - - - - - - -
-
- -
- -
-
-

- - Optimizing antibody affinity and stability by the automated design of the variable - light-heavy chain interfaces

- -
    - - - - - - - - - - - - - - +
    +
    + +
    + +
    +
    +

    + + Optimizing antibody affinity and stability by the automated design of the variable light-heavy + chain interfaces

    + +
      + + + + + + + + + + + + + + +
    +
      +
    1. Department of Biomolecular Sciences, Weizmann + Institute of Science, Rehovot, Israel
      2. +
    2. Department of Structural Biology, Weizmann + Institute of Science, Rehovot, Israel
      3. +
    3. Israel Structural Proteomics Center, Weizmann + Institute of Science, Rehovot, Israel
      4. +
    + +
    +

    Abstract

    + +

    Antibodies developed for research + and clinical applications may exhibit suboptimal stability, expressibility, or affinity. + Existing optimization strategies focus on surface mutations, whereas natural affinity + maturation also introduces mutations in the antibody core, simultaneously improving stability + and affinity. To systematically map the mutational tolerance of an antibody variable fragment + (Fv), we performed yeast display and applied deep mutational scanning to an anti-lysozyme + antibody and found that many of the affinity-enhancing mutations clustered at the variable + light-heavy chain interface, within the antibody core. Rosetta design combined enhancing + mutations, yielding a variant with tenfold higher affinity and substantially improved + stability. To make this approach broadly accessible, we developed AbLIFT, an automated web + server that designs multipoint core mutations to improve contacts between specific Fv light + and heavy chains (http://AbLIFT.weizmann.ac.il). We applied AbLIFT + to two unrelated antibodies targeting the human antigens VEGF and QSOX1. Strikingly, the + designs improved stability, affinity, and expression yields. The results provide + proof-of-principle for bypassing laborious cycles of antibody engineering through automated + computational affinity and stability design.

    +
    +

    Introduction

    +

    High-affinity natural antibodies are + generated through an iterative process of mutation and selection for antigen binding known as + affinity maturation. Affinity maturation also selects antibodies that exhibit higher stability + and expressibility [1], both of which are essential parameters in the + development of antibodies into research or medical tools [2]. In + recent decades, synthetic antibody repertoires have been widely adopted in antibody discovery + and optimization, providing greater control over the selection process than animal immunization. + In this approach, a library of antibody variable fragments (Fv) is displayed, for instance on + yeast cells, and screened to select high-affinity binders or to improve the affinity of existing + antibodies [3]. These methods are powerful [4,5], but a large fraction of high-affinity antibodies + isolated from synthetic repertoires exhibits impaired stability [6]. Impaired + stability can limit expression yields and increase aggregation propensity [7], + resulting in high production costs [8], fast + antibody clearance from circulation and adverse immune responses in patients [9]. Thus, + the tradeoff between antibody stability (including solubility and expressibility) and affinity + can delay and even block the development of antibodies in research and medicine [10]. General methods to improve antibody stability + while maintaining or even increasing affinity are therefore urgently needed to reduce the + attrition rate in antibody development pipelines [11].

    +

    To boost antibody stability and + affinity, computational design methods have been developed. These have focused on the Fv + complementarity-determining regions (CDRs), which are typically in direct contact with the + antigen. Some methods, for instance, improved electrostatic complementarity with the antigen + [12] or eliminated hydrophobic surface patches [13–18]. Natural + and laboratory affinity maturation, by contrast, introduce mutations in both the CDRs and the + antibody core [1,5]. Core + mutations may improve antibody stability by eliminating packing defects, and they may enhance + affinity by preorganizing the antigen-binding site [1]. Although + mutations in the core may contribute less to affinity than ones in the CDRs, they are more + likely to retain the intricate structure of the antigen-binding site and are therefore likely to + be compatible with affinity-enhancing mutations in the CDRs that were obtained through other + optimization strategies. The antibody core, however, is a large and densely packed region, + complicating the design of improved variants [5,19]. For instance, we recently presented and + validated an automated computational strategy, called PROSS [20], for + protein-stability design. Similar to other stability design algorithms [21], + however, PROSS only rarely introduces core mutations and does not improve binding affinity + [22]. Reliable prediction of mutational effects in the + antibody core and especially successful design of networks of interacting multipoint core + mutations has, therefore, remained a challenge [21,23].

    +

    Recently, deep mutational scanning + has been successfully applied to study the mutational tolerance of antibodies and other binders + [24–30]. In this + approach, amino acid positions in the binder are systematically mutated to all of the natural + amino acid identities; the mutants are pooled into one library containing all single-point + mutations; populations of binders are selected from this library using in vitro display and high-throughput + screening; and the selected and unselected populations are subjected to deep-sequencing analysis + to infer which mutations are enriched relative to the starting binder, thus systematically + identifying affinity-enhancing mutations. Deep mutational scanning has been very successfully + used to guide protein design and engineering of improved binders [24,26,31,32] but has not yet been exploited to improve + protein-design methodology itself. The large improvements in the reliability and breadth of + detection of affinity-enhancing mutations through deep mutational scanning inspired us to + revisit the challenge of accurately predicting the effects of core mutations on antibody + affinity and stability. Deep mutational scanning guided us in uncovering a cluster of core + positions at the light-heavy chain (vL-vH) interface where many affinity-enhancing mutations + occurred. We then used these systematic data to establish general rules for computational design + of antibody Fvs with improved vL-vH interactions; we implemented these rules as an automated + method, called AbLIFT and made it available through a web server (http://AbLIFT.weizmann.ac.il). AbLIFT designs + exhibited striking gains in affinity, stability, and expressibility in two unrelated antibodies + that target the human disease markers Vascular-Epidermal Growth Factor (VEGF) and the enzyme + Quiescin Sulfhydryl Oxidase 1 (QSOX1).

    +

    Results

    +

    A cluster of + affinity-enhancing mutations at the vL-vH interface

    +

    To study the mutational tolerance of + an antibody Fv, we selected 135 positions in the anti-lysozyme antibody D44.1 [33] for deep mutational scanning (S1A Fig). The positions + encompassed most of the CDRs, the vL-vH interface and additional peripheral positions (Fig 1A). D44.1 and each + point mutant were genetically encoded as single-chain variable fragments (scFv) in which the + heavy chain was fused to the light chain via a flexible linker, and the genes were transformed + into yeast cells for binding and expression screens by yeast display [3]. + Following incubation with hen egg-white lysozyme, the top 15% binders were selected from this + library, and the same library was also subjected to low-stringency selection for expression + levels to provide a baseline. The plasmids containing scFv-encoding genes from both selections + were purified, amplified by PCR, and subjected to deep sequencing, resulting in 8 million + high-quality reads [32]. We then determined the enrichment of each mutant + relative to D44.1 as the ratio between populations selected for binding and expression (Fig 1B).

    +
    +

    Computational mutation-tolerance mapping

    -

    The successful optimization of - antibody affinity and stability encouraged us to fully automate the design procedure, - eliminating the requirement for experimental deep mutational scanning. We, therefore, sought - a general computational strategy that would predict which mutations in the vL-vH interface - were likely to enhance affinity and stability, with the goal of developing a general - computational procedure for mutational-tolerance mapping. To achieve this goal, we exploited - the large experimental dataset of the D44.1 mutational tolerance map, comprising 2,294 point - mutations, for training. At each of the mutated D44.1 Fv positions, we used Rosetta to - compute the changes to native-state energy due to each of the 19 amino acid mutations (ΔΔG). Using a - multiple-sequence alignment of homologous Fvs, we additionally computed each point - mutation’s evolutionary-conservation score, as represented in a Position-Specific Scoring - Matrix (PSSM) [38]. These two computed parameters provide - complementary predictions of mutational tolerance: the former predicts the impact of a - mutation on native-state stability and the latter discriminates between evolutionarily - tolerated mutations and those that have been purged by evolution. The use of these two - parameters has recently led to substantial improvement in design accuracy in binder and - enzyme design challenges in our laboratory [20–22,38–43]. We specifically used these two parameters - because they can be computed for any antibody given an accurate experimental or model - structure, allowing us, in principle, to compute mutational tolerance maps for any antibody - Fv.

    -

    We systematically screened - different combinations of ΔΔG and PSSM thresholds to determine which - combination optimally discriminates enhancing from deleterious mutations as observed in the - experimental mutational-tolerance map of D44.1. We defined the prediction true-positive rate - (TPR) as the proportion of correctly predicted affinity-enhancing mutations (>1.5-fold - enrichment according to deep mutational scanning) and the true-negative rate (TNR) as the - proportion of correctly predicted deleterious ones (enrichment ratio <1). The resulting - phase space of (PSSM, ΔΔG) - thresholds revealed an expected tradeoff, wherein high TNR came at the cost of low TPR, and - vice versa (Fig 3A). The - likelihood of obtaining a multipoint mutant without a single deleterious mutation can be - roughly approximated by TNRn, where n is the number of mutations. Given the - large size of the vL-vH interface (20–30 positions [44]), we - aimed for a large maximum number of mutations in each multipoint mutant (n = 10) and therefore selected a - stringent cutoff TNR = 94%, providing a rough estimate that 50% of designs with ten - mutations would not contain a single deleterious mutation (Fig 3B). At this high TNR, the TPR - is only 40%, reflecting the challenging tradeoff in the design of multipoint variants. We - anticipate that in certain applications, such as in the design of improved antibodies for - therapeutic application, a smaller number of mutations may be preferred. In such cases, a - lower TNR and therefore a higher TPR may be implemented, and Fig 3C provides a guide for - choosing different (PSSM, ΔΔG) thresholds. Instructions for computing - a mutation-tolerance map based on any structure of an antibody Fv are available as - Supplemental Data, and the AbLIFT web server enables user control of these parameters.

    -
    -
    -

    - Mutational-tolerance mapping by Rosetta atomistic energy calculations (ΔΔG) and - evolutionary-conservation scores (PSSM).

    -

    (a) Systematic analysis of - combinations of PSSM and ΔΔG thresholds reveals an expected - tradeoff in prediction accuracy of mutational tolerance. Each combination of thresholds - (-10≤PSSM≤10; -10≤ΔΔG≤20 Rosetta energy units, R.e.u.) - results in a different fraction of correctly predicted enhancing or deleterious - mutations (true-positive rate [TPR] and true-negative rate [TNR], respectively) observed - in the deep mutational scanning data of D44.1. (b) All (PSSM, ΔΔG) combinations are plotted with - their TPR and TNR values, and the Pareto-optimal front is indicated in orange. Several - combinations of (PSSM, ΔΔG) thresholds are indicated by blue - triangles. (c) - The thresholds (PSSM≥-1, ΔΔG≤+1 R.e.u.) result in a TNR of 94% - and TPR of 40% and were used in subsequent design calculations. Optimal ΔΔG cutoffs may vary - depending on the energy function and the relaxation protocol. For details on these - choices, see Methods.

    -
    -
    + id="deep-mutational-scanning-of-an-antibody-variable-fragment-fv">Deep mutational scanning + of an antibody variable fragment (Fv). +

    (a) 135 positions across the Fv of the + anti-lysozyme antibody D44.1 (encompassing the vL-vH interface and all positions from the + antigen-binding surface to the level of the disulfide-linked cysteines) were individually + diversified using degenerate codons (NNS) to encode all point mutations. The variants were + transformed into yeast cells, subjected to low-stringency selection for binding (green + spots) and for expression (purple + green spots), and then to deep-sequencing analysis. + (b) 34 Fv positions + exhibited enhanced binding upon mutation (blue). Amino acids (x-axis) are numbered according + to ref. [33]. Blue, red and gray encode mutations that are + enriched, depleted, or ones with insufficient data, respectively. Amino acid identities in + the parental antibody are indicated in one-letter code for each position. (c) At several positions, + more than five alternative identities enhanced affinity, indicating that the combinatorial + sequence space of affinity-enhancing multipoint mutants is large. Positions at the vL-vH + interface are colored purple. (d) Mutations were ranked according to + their enrichment ratios, revealing that many (30%) of the top affinity-enhancing mutations + occurred at the vL-vH interface (30 identities at the eight positions with enrichment over + the parental identity above threefold are marked in blue triangles). (e) Spheres indicate positions on the + molecular structure of the bound HEL-D44.1 complex (PDB entry 1MLC) in which mutations + exhibited at least threefold enrichment relative to D44.1. A cluster of enriched positions + at the vL-vH interface, mostly belonging to the antibody framework, is highlighted in + purple. HEL—hen egg-white lysozyme.

    +
    +
    +

    We found affinity-enhancing mutations + at 34 positions, mostly within the CDRs, as expected (Fig 1C). We also noticed a surprisingly + large cluster of eight positions at the vL-vH interface where affinity-enhancing mutations + occurred, although they were not in direct contact with the antigen (Fig 1D and 1E). This cluster of + affinity-enhancing mutations in the vL-vH interface is intriguing for four reasons: (1) the + vL-vH interface mediates the assembly of the Fv from the two antibody chains, and mutations in + this region have the potential to also enhance stability through improved Fv assembly [1]; (2) the genetic pairing of light and heavy chains + during germline antibody generation is a random process which may result in suboptimal vL-vH + interfaces, flexibility in the antigen-binding site [34], and + therefore in lower antigen affinity [35]; (3) + this region is distant from the mutational hotspots in the CDRs and may not be fully optimized + in the course of natural affinity maturation [36]; and (4) + antibody-engineering procedures, such as humanization or CDR grafting may inadvertently + compromise the structural integrity of this region by mispairing CDRs and frameworks [37]. Based on these considerations, we hypothesized + that the vL-vH interface may be especially amenable to the design of multipoint mutants that + simultaneously improve stability and affinity in both natural and engineered antibodies.

    +

    Combining mutations in densely packed + protein cores, such as the vL-vH interface, is challenging, however, because inadvertently + introduced voids, steric overlaps, or mispaired polar amino acid side-chains can lead to protein + instability, misfolding, and aggregation [21,23]. We, therefore, asked whether the + mutational-tolerance map could guide Rosetta design in finding improved multipoint mutants at + the vL-vH interface. In preliminary calculations starting from the lysozyme-bound D44.1 + structure (PDB entry: 1MLC), we restricted Rosetta combinatorial design to the eight positions + and 38 identities (including the wild type identities) at these positions that showed at least + threefold enrichment relative to D44.1 according to the mutational-tolerance map (Fig 1B and 1E). The + resulting design, however, comprised only three conservative mutations, suggesting that the + dense packing and backbone rigidity at the vL-vH interface restricted sequence optimization. We, + therefore, repeated design calculations but this time excluded the wild type identities at the + eight positions, forcing the design of an optimal combination of mutations only from those that + were substantially enriched in deep mutational scanning. We iterated sequence design and + backbone and sidechain minimization to promote the acceptance of even radical mutations yielding + design D44.1des with + eight mutations. As a preliminary qualitative test, we analyzed D44.1des binding to lysozyme and to seven of + the eight single-point mutations formatted as scFvs using yeast display [3]. As + expected, each of the point mutations improved the apparent binding affinity relative to D44.1; + and yet, the multipoint D44.1des exhibited a substantial improvement + in apparent affinity compared to the single-point mutations (S1B Fig).

    +

    To determine what molecular factors + might underlie higher affinity in D44.1des, we expressed the design as an + antigen-binding fragment (Fab) and determined its structure by X-ray crystallography in the + absence of lysozyme (S1 + Table). Despite eight core mutations, the overall agreement between D44.1des and the bound structure + of D44.1, which served as the starting point for designing D44.1des, was excellent (S2 Fig): The two structures deviated by + <1 Å backbone root-mean-square deviation (rmsd) and in side-chain residues comprising the + lysozyme-binding site. The mutations apparently improved various molecular aspects of the vL-vH + interface including interface packing, solvation, and backbone rigidity (Fig 2A). Next, we tested lysozyme + binding by D44.1 and D44.1des (both expressed and purified as Fab) + using surface-plasmon resonance (SPR). D44.1des exhibited nearly tenfold improvement + in affinity (KD of 15 versus 135 nM for D44.1des and D44.1, + respectively), with a 25-fold slower off-rate (8 * 10−4 s-1) (Fig 2B). D44.1des also exhibited improved thermal + denaturation and aggregation resistance (Fig 2C and 2D).

    +
    +

    Automated affinity and - stability design in the vL-vH interface

    -

    We next sought to develop a - general and fully automated design protocol for improving molecular interactions across the - vL-vH interface. AbLIFT starts by computing a mutational-tolerance map at the vL-vH - interface using the approach described above; it then exhaustively enumerates the multipoint - combinations of tolerated mutations; ranks them by energy, and selects low-energy variants - for experimental testing. This algorithm resembles our recently described FuncLib method for - designing functionally diverse enzyme repertoires [41], - with the key differences that AbLIFT is applied to the core of obligatory binding surfaces - rather than to solvent-exposed surfaces and most importantly, AbLIFT does not require an - initial design round of protein stabilization.

    -

    To validate AbLIFT, we chose two - antibodies as subjects for design: the synthetic antibody G6, which targets human - Vascular-Endothelial Growth Factor (VEGF) [45], and - an engineered variant of the 492.1 antibody, designated h492.1, which targets human Quiescin - Sulfhydryl Oxidase 1 (QSOX1). QSOX1 is a multi-domain disulfide-catalyst that is - overproduced in tumors [46] and is a potential drug target [47,48]. - These antibodies are unrelated to D44.1 or to one another and are the products of protein - engineering. G6 is widely used in animal studies and resulted from a phage-displayed - synthetic Fab library of the light chain with a heavy chain sequence of an anti-mVEGF - antibody (K + Gains in affinity, stability, and aggregation resistance through vL-vH interface design + guided by deep mutational scanning. +

    (a) Comparison of the starting + anti-lysozyme antibody D44.1 and the crystal structure of design D44.1des (PDB entries: 1MLC and 6GC2, + respectively) showed improved interactions across the interface and likely increased + backbone rigidity. (b) SPR kinetic analysis of hen + egg-white lysozyme (HEL) binding with threefold dilutions of HEL from a maximal + concentration of 333 nM for D44.1 and 111 nM for D44.1des (kinetic fits shown in gray). + D44.1 exhibited kD approximately 1 nM) [49]. The h492.1 antibody was obtained by fusing - the variable domains from the high-affinity (a = 1.5 * 105 M-1s-1, kd = 0.021 s-1, and KD approximately 1 nM) - QSOX1-inhibiting murine antibody 492.1 onto a human IgG scaffold. Following this fusion, - h492.1 could not be expressed to detectable levels in a recombinant cultured human cell - system, frustrating its further development. Thus, with these two targets, we sought to test - the ability of AbLIFT to optimize high-affinity antibodies that resulted from conventional - antibody-engineering procedures, whether well-behaved ones (G6) or ones that showed low (or - no) detectable expression levels (h492.1).

    -

    The computed mutational-tolerance - map of G6 (starting from its bound structure, PDB entry 2FJG) at 30 vL-vH interface - positions defined 26 affinity-enhancing mutations at 11 positions. To achieve significant - improvement of vL-vH interface packing, we sought to design multipoint mutants with 4–10 - mutations relative to G6, resulting in a tolerated sequence space of 203,835 unique - multipoint mutants. All multipoint mutants were modeled in Rosetta, including by a backbone - and side-chain minimization step, which is essential for enabling cavity-filling - small-to-large mutations [50,51], and - the models were then ranked by energy. 53% of the mutants (>100,000) exhibited energies - as favorable as or better than the G6-bound antibody. Therefore, although the exhaustive - enumeration of this large number of mutants is computationally demanding (approximately - 6,000-CPU hours), the very large number of potentially improved designs makes a compelling - case for exhaustive enumeration and ranking of variants within the tolerated sequence space. - Furthermore, the computed mutational-tolerance map focuses exhaustive enumeration on a - subset of stable multipoint mutants within the vast hypothetical sequence space of mutants - at the vL-vH interface (2030 = 1039 unique sequences), >99% of - which are predicted to have reduced stability compared to the parental antibody (S3 Fig).

    -

    We clustered the designs, - eliminating ones that had fewer than four mutations relative to one another and selected the - 18 lowest-energy ones for experimental testing. The designs were formatted as scFvs, and - their binding signals relative to the G6 antibody were first qualitatively measured at 8 nM - VEGF concentration using yeast display [3] - (Fig 4A). - Encouragingly, seven designs (approximately 40%) showed comparable or higher binding signal - at this concentration. The best two designs, G6des1 and G6des13, were expressed as Fabs. When - subjected to Ni-NTA purification, G6 exhibited multiple bands, indicative of sample - heterogeneity, whereas, remarkably, both designs eluted mostly in the size expected for a - Fab (S4A and - S4B Fig) [52].

    -
    -
    -

    Fully - automated antibody stability and affinity optimization using AbLIFT.

    -

    (a) G6 and 18 low-energy designs, - each encoding 4–10 mutations relative to G6 (number of mutations is indicated above the - bars) were tested for binding using yeast display at 8 nM VEGF concentration, resulting - in seven designs that showed comparable or higher binding signal compared to G6. G6des1 and G6des13 were chosen - for further characterization (colored in blue and orange, respectively). (b) SPR kinetic - analysis of VEGF binding with twofold dilutions from a maximal concentration of 100 nM - by G6, G6des1, - and G6des13 Fabs - demonstrated faster binding on-rate in the designs (ka = 2.3 * 105 M-1s-1, 3.27 * 105 M-1s-1 and 5.3 * 105 M-1s-1, respectively). G6des13 also improved - binding off-rate (kd = 3.2 * 10−5 s-1 compared to 6 * 10−5 s-1 in G6), resulting - in an improved dissociation constant (KD = 60 pM compared to 270 pM - in G6). (c & - d) Thermal denaturation and temperature of aggregation onset experiments, - respectively, using microscale thermophoresis indicated substantially higher apparent - stability in the designs. (e) Computational mutation-tolerance - mapping indicated 11 positions at the vL-vH interface of the anti-VEGF antibody G6 - (spheres) with potentially tolerated mutations. Thumbnails indicate selected mutations - in a model structure of G6des13 relative to G6 (gray). - (f) Expression - levels in HEK293 cells of G6 and the designs formatted as IgG were measured using - Western blot analysis showing approximately an order of magnitude improvement in IgG - expression levels for the designs. (g) Native mass-spectrometry - analysis exhibited higher tolerance to applied collision energy in G6des13 compared to G6, both - formatted as IgG. The error bars represent standard deviations inferred from three - repeats.

    -
    -
    -

    Next, the designs’ affinities for - VEGF were determined using SPR (Fig 4B). Both designs improved - binding on-rate, and G6des13 also improved the off-rate, - resulting in fivefold improvement in D = 137 nM. D44.1des exhibited ka = 5.3 * 104 M-1s-1, kd = 7.9 * 10−4 s-1, and KD relative to G6. Both designs - also exhibited substantial improvements in thermal stability and the temperature of - aggregation onset (19° C and 10° C, respectively) (Fig 4C and 4D). We examined the - model structure of G6des13, which comprised six mutations - at the vL-vH interface relative to G6, finding that the mutations were likely to improve the - interface through backbone rigidification and the introduction of a new buried polar - hydrogen-bond network (Fig - 4E). Such cooperative interaction networks do not typically arise in - conventional antibody affinity-maturation processes (either in nature or the laboratory), - which select mutations in a stepwise manner and are therefore biased towards additive rather - than cooperative multipoint mutations. Introducing accurate new polar interaction networks - is also a fundamental challenge for computational design [53,54] and the use of evolutionary constraints - during design has recently been shown to overcome this challenge [42].

    -

    We next tested the stability and - expressibility of the VEGF designs formatted as full-length IgGs. We expressed G6, G6des1, and G6des13 in HEK293 cells - and found that the designs exhibited nearly an order of magnitude higher expression level - than G6 (Fig - 4F). We next measured the relative stabilities of G6 and G6des13 using native mass - spectrometry [55] under reducing conditions by titrating the - collision energy (Fig - 4G). We found that G6 IgG disassembly started at lower collision energy - compared to G6des13, - indicative of the design’s higher stability (S5 Fig). We, therefore, concluded - that AbLIFT could substantially improve expressibility, stability, and affinity, regardless - of whether the antibody was formatted as Fab or IgG.

    -

    We applied the same computational - strategy to h492.1, in which the Fv was derived from a murine antibody and the constant - regions were derived from human IgG1. Since h492.1 failed to show detectable expression in - HEK293 cell cultures, we started the computational design from the structure of the murine - 492.1 parental antibody in complex with QSOX1 (PDB entry: 4IJ3) [47]. We - selected the 20 lowest-energy, sequence-clustered AbLIFT designs, fused them to human IgG1 - constant domains and subjected them to HEK293-expression screening from crude cell lysate - supernatant. Dot-blot analysis showed detectable expression levels for all 20 designs, in - clear contrast with the lack of detectable expression for h492.1 (Fig 5A). We further quantitated - expression levels using Western blot, revealing substantial variation in the expression - levels among the designs (Fig - 5B). In parallel, we examined the levels of QSOX1 inhibition by the 20 - designs, finding that 50% showed high levels of QSOX1 inhibition (S6 Fig). Based on activities and - expression levels, we selected h492.1des3 and h492.1des18 for further analysis. These - designs were purified and added to QSOX1 activity assays to test for inhibition. h492.1des18 showed comparable - inhibitory levels to the murine parent antibody when provided at equimolar amounts to a - typical physiological concentration of QSOX1 (25 nM) as found in human serum (Fig 5C) [56]. This analysis demonstrated that h492.1des18 almost completely - recovered the activity of the parental antibody while gaining high expression levels - (approximately 75 mg/L supernatant). Structural analysis indicated that this design improved - packing at the vL-vH interface (Fig 5D), demonstrating that in some - cases optimizing this region could have a dramatic effect on the expression levels of - engineered antibodies.

    -
    -
    -

    - Substantial increase in antibody expression yields following AbLIFT design.

    -

    (a) Dot blot analysis showed no - detectable expression for h492.1 in HEK293 cells, whereas all 20 designs showed - detectable levels of expression. (b) Relative expression levels of - the 20 designs using Western blot analysis. h492.1des3 and h492.1des18 showed high expression and - were selected for further analysis. (c) QSOX1 inhibitory activity assay - using the parental 492.1 antibody and two designs. The inhibitory activity was measured - for each antibody in a sulfhydryl oxidase assay using a physiological concentration of - QSOX1 (25 nM). h492.1des18 showed comparable - inhibitory activity relative to the parental antibody, with only a slight decrease when - provided at sub-stoichiometric amounts (10 nM). (d) The structural context of - mutations in h492.1des18 (color) relative to the - experimental structure of 492.1 (gray). Spheres indicate the locations of the mutations, - and the thumbnail shows two of the four designed mutations, which improve interchain - packing and rigidify the backbone at the vL-vH interface according to the model - structure.

    -
    -
    -

    Finally, we asked whether there - were any sequence features in common among the designs (S3 and S4 Tables). - Strikingly, position 43L (Chothia numbering) was mutated to - Pro in D44.1des and - in >60% of the G6 and h492.1 designs. Position 43L is located in a tight turn that - connects two neighboring β strands, away from the CDRs, but Pro is not the consensus - identity at this position (Ala and Ser are preferred). Furthermore, mutations at this - position may have an important effect on the rigid-body angle formed by the variable light - and heavy domains [44,57], and - it is, therefore, unlikely that this mutation would universally improve antibody stability - and affinity. Other than this mutation to Pro, we did not observe common sequence features - among the designs. Overlapping but non-identical sets of positions were varied in each of - the three case studies presented here, and the mutations at aligned positions were - dissimilar. We, therefore, concluded that the designs improved interactions across the vL-vH - interface through a variety of mechanisms that depended on the specific molecular structure - of the parental antibodies.

    -

    Discussion

    -

    Our study demonstrates that - improved interactions across the vL-vH interface may result in substantial optimization of a - range of essential parameters for antibody development, including expressibility, stability, - and affinity. The automated AbLIFT strategy enables the design of cooperative networks of - multipoint mutations in the antibody core that are likely to be inaccessible to experimental - affinity maturation processes since these latter methods select mutations in a stepwise - manner. Since AbLIFT impacts the antibody core and does not alter the structure of the - antigen-binding site, the designed mutations cooperate with surface mutations identified - through conventional antibody-engineering processes to further increase affinity and - stability. AbLIFT may be particularly beneficial in antibodies, such as G6 and h492.1, which - were the product of antibody-engineering approaches that might compromise antibody - structural integrity, resulting in reduced affinity or stability. Moreover, antibody - structure-prediction methods now often produce atomically accurate models at the vL-vH - interface (though still not at the CDR H3) [58–60], suggesting that by restricting design to the - framework regions, AbLIFT may in some cases enable antibody optimisation even in the absence - of an experimental structure. We note, however, that AbLIFT considers only phylogenetic - information and molecular energetics and disregards immunogenicity, which may be an - important consideration in antibodies developed for clinical use. To address this concern, - the AbLIFT web server enables complete control over the design sequence space and can be - used to eliminate mutations with immunogenic potential.

    -

    The surprisingly broad ability of - vL-vH design to optimize antibody properties is consistent with the Colman interface-adaptor - hypothesis, according to which the formation of the Fv from two chains renders it flexible - [34]. According to this hypothesis, Fv flexibility - is likely to be an adaptive property selected by evolution to broaden molecular recognition - by each individual antibody to a range of antigens through induced fit or conformational - selection [61], thereby solving the conundrum of how a large - but finite antibody repertoire could recognize a potentially infinite range of antigens - [62]. Flexibility, however, might come at a cost, - since an Fv that exhibits flexible vL-vH pairing may occupy multiple molecular states that - compete with the binding-competent state, thus lowering antigen-binding affinity. - Flexibility may moreover result in misfolding or transient dissociation of the two variable - chains, resulting in terminal aggregation or degradation by the cellular proteostasis - machinery, thereby lowering expression yields. In extreme cases, poorly defined packing at - the vL-vH interface can lead to substantial rearrangements of the antibody variable domain - during binding [63], and such rearrangements could lower - antigen-binding affinity and specificity. Therefore, while the interface-adaptor hypothesis - neatly explains why flexibility at the vL-vH interface is advantageous in early steps of - antibody selection, broad specificity and marginal vL-vH interface stability become - liabilities in later stages of antibody development into research or therapeutic tools. We - anticipate that AbLIFT will have a wide scope to automatically and reliably improve - stability, solubility, expressibility, affinity, and structural integrity in numerous - antibodies in which these important properties are compromised.

    -

    Methods

    -

    D44.1 genetic library construction

    -

    Forward and reverse primers with - the degenerate codon NNS were generated for all 135 positions on the Fv of D44.1, - essentially as described [64]. Primers were ordered from Sigma - (Sigma-Aldrich, Rehovot, Israel) and were used to introduce all possible amino acids per - position by QuickChange mutagenesis [65]. - Next, the PCR product of each position was transformed into yeast (EBY100 cells) and plated - on SD-Trp as described [66]. Briefly, plates with more than 400 colonies - were scraped with 1 ml SDCAA, 50 μl was added to 5 ml SDCAA tube and cells were then grown - at 30°C overnight. The point mutants were split into six libraries, corresponding to - positions that were at most 130 bp apart from one another to enable deep mutational scanning - using 150 bp reads.

    -

    Yeast surface display selection for - libraries

    -

    Yeast-display experiments were - conducted essentially as described [3]. - Briefly, yeast cells were grown in selective medium SDCAA overnight at 30°C. The cells were - then resuspended in 10 ml induction medium and incubated at 20°C for 20 h. 107 cells were then used - for yeast-cell surface display experiments: cells were subjected to primary antibody (mouse - monoclonal IgG1 anti-c-Myc (9E10) sc-40, Santa Cruz Biotechnology) for expression monitoring - and biotinylated ligand at 90 nM lysozyme (GeneTex) in PBS-F for 30 min at room temperature. - The cells then underwent a second staining with fluorescently labeled secondary antibody - (AlexaFluor488—goat-anti-mouse IgG1 (Life Technologies) for scFv labeling, Streptavidin-APC - (SouthernBiotech) for ligand labeling) for 10 min at 4°C. Next, the cell fluorescence was - measured and cells were collected under sorting conditions for expression and top 15% - binders. The selection gates were calibrated using the wild-type scFv D44.1 and these gates - were subsequently applied to the library constructs. Following fluorescence-activated cell - sorting (FACS), cells were grown in SDCAA for 1–2 days and plasmids were extracted using - Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research).

    -

    Yeast surface display of anti-VEGF scFvs

    -

    18 designs of improved binding - affinity antibodies against VEGF and the wild-type G6 Fvs were ordered from Twist - Biosciences as scFvs. These, as described above, were amplified by PCR and cloned into - pCTCon2 using homologous recombination in yeast [66]. The - plasmids were extracted by Zymoprep kit II, transformed into bacteria for sequence - validation and verified clones were transformed to yeast for display [3]. The - wild-type and designed antibodies were tested for binding by flow cytometry with 8 nM - biotinylated VEGF (Recombinant Human VEGF 165, Biotinylated Protein R&D systems).

    -

    DNA preparation for deep sequencing

    -

    To connect the DNA adaptors for - deep sequencing, the plasmids extracted from the libraries were amplified using Phusion - High-Fidelity DNA Polymerase (ThermoFisher) in a two-step PCR protocol.

    -

    PCR 1:

    -

    (barcode: - CTCTTTCCCTACACGACGCTCTTCCGATCT)

    -

    >forward (seg1):<barcode>AGGGTCGGCTAGCCATATG

    -

    >forward (seg2):<barcode>GGATCGAATGGGTTAAACAACGT -

    -

    >forward (seg3):<barcode>ACACCTCCTCTAACACCGC

    -

    >forward (seg4):<barcode>CTGGTGGCGGTGGCTC

    -

    >forward (seg5):<barcode>GCCGTGCGTCTCAGTCTATT

    -

    >forward (seg6): <barcode>CCATCTCGTTTCTCCGGC

    -

    >reverse: CTGGAGTTCAGACGTGTGCTCTTCCGATCTGGATCGAATGGGTTAAACAACGT -

    -

    The PCR product for each - population (expressed and top 15% of binders for each of the six libraries) was cleaned - using Agencourt AMPure XP (Beckman Coulter, Inc.) and 1 μl from a 1:10 dilution was taken to - the next PCR step for index labeling using KAPA Hifi DNA-polymerase (Kapa Biosystems, - London, England):

    -

    >forward: - AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC

    -

    >reverse: - CAAGCAGAAGACGGCATACGAGAT<index>GTGACTGGAGTTCAGACGTGTGC

    -

    Top 15%—index: CAATAGTC

    -

    Expressed—index: TTGAGCCT

    -

    All the primers were ordered as - PAGE-purified oligos. The concentration of the PCR product was measured using Qu-bit assay - (Life Technologies, Grand Island, New York).

    -

    - Deep-sequencing runs

    -

    DNA samples were run on an - Illumina MiSeq using 150-bp paired-end kits. The FASTQ sequence files were obtained for each - run, and customized scripts were used to generate the selection heat maps from the data as - previously described [64]. Briefly, the script starts by translating - the DNA sequence to amino acid sequence; eliminates sequences that harbor more than one - amino acid mutation relative to wild type and also sequences that failed the QC test; counts - each variant in each population; and eliminates variants with fewer than 100 counts in the - reference population (to reduce statistical uncertainty).

    -

    - Sequencing analysis

    -

    To derive the mutational - landscapes we compute the frequency Pi,j of each mutant relative to - wild-type in the selected and reference pools, where i is the position and j is the substitution, relative to - wild-type:

    -

    where count is the number of - reads for each mutant. The selection coefficients are then computed as the ratio:

    -

    where selected refers to the top 15% binding - population and reference refers to the reference population (Expression). The resulting Si,j values are then - transformed to −ln - enrichment values:

    -

    - Computational methods

    -

    All Rosetta design simulations - used git version fb77c732b4f08b6c30572a2ef7760ad3bb4535ca of the Rosetta biomolecular - modeling software, which is freely available to academics at http://www.rosettacommons.org. - Position-Specific Scoring Matrices (PSSM) for designed antibodies against VEGF (PDB: 2FJG) - and against QSOX1 (PDB: 4IJ3) were collected as described in ref. [38] and - are distributed with the Rosetta release. RosettaScripts [67] and - command lines are available in Supplemental Data. As in the AbDesign method [38], - separate PSSMs were generated for CDRs 3 and for CDRs 1, 2 and the framework by aligning - structurally similar antibodies in the PDB and selecting only sequences that did not exhibit - gaps relative to the query sequence; furthermore, a strict cutoff of ≤ 0.5 Å - backbone-carbonyl rmsd was used to eliminate structurally divergent sequences. Thus, the - PSSMs were only based on structural considerations and not on sequence homology or source - organism.

    -

    We refined each bound PDB - structure by four iterations of side-chain packing and side-chain and backbone minimization, - saving the minimum-energy structure. Computational mutation scanning was applied to the - refined structure using the FilterScan filter in Rosetta [24]. At - every position, each allowed mutation (that is, every amino acid identity with PSSM score - ≥-1) was modeled singly against the background of the refined structure. Protein side chains - within 8 Å of the modeled mutation were repacked, and side-chain and constrained backbone - minimization were used to accommodate the mutation. The energy difference between the - refined structure and the optimized configuration of the single-point mutant was calculated - using the talaris2014 energy function [68]. The - energy threshold used to define the tolerated mutation space was +1 R.e.u. We next - enumerated all possible combinations of mutations against VEGF (203,835 models) and against - QSOX1 (491,235 models), modeled them in Rosetta and relaxed them by sidechain packing and - sidechain, backbone and rigid-body minimization with harmonic backbone coordinate - restraints. Designs were ranked based on their energy and the top 18 designs differing by - 4–10 mutations relative to one another (VEGF) (S2 Table) and the top 20 designs - differing by 3–14 mutations relative to one another (QSOX1) (S3 Table) were selected for - experimental characterization.

    -

    The - AbLIFT web-server

    -

    The web-server implements several - improvements relative to the method used to design the G6 and h492.1 variants [41]. In the AbLIFT web-server, the - multiple-sequence alignment used to construct the PSSM is first filtered to eliminate all - loops and secondary-structure elements that exhibit any gaps relative to the query sequence. - Furthermore, the web-server implements more accurate atomistic scoring and enables greater - user control: it uses the recent Rosetta energy function ref15 [69] with - improved electrostatics and solvation potentials relative to the previous Rosetta energy - function talaris and allows the user to manually modify the tolerated sequence space (for - instance, based on prior experimental data or to eliminate potential immunogenic sequence - signatures). Accordingly, ΔΔG and PSSM cutoffs may be different from - those used to in the designs described in the paper, and the web server provides user - control over these parameters.

    -

    Bacterial expression and - purification (D44.1 and D44.1des)

    -

    The design and wild-type were - transformed into RH2.2 plasmid for expression as Fabs, where the heavy chain was - N-terminally His-tagged and the light chain was expressed as a separate protein. Both chains - contain a secretion sequence for direction to the periplasmic space, where they fold and - dimerize. Restriction-free cloning was done using Kapa HiFi Hotstart Readymix (Kapa - Biosystems) according to the manufacturer’s protocol.

    -

    Cells were induced with 1 mM IPTG - at OD600 = 0.6, transferred to 20°C, and harvested after 20 h. The cells were then - resuspended in buffer A [20 mM phosphate buffer pH 6.2, 150 mM NaCl] and sonicated. The - supernatant was harvested by centrifugation (20,000 × g, 1 h), filtered, and loaded on HiTrap - TALON crude 1 ml column (GE Healthcare). Then it was washed with 15–20 bed volumes of buffer - A, and then eluted with buffer B [20 mM phosphate buffer pH 6.2,150 mM NaCl, 150 mM - imidazole]. Imidazole was removed from the eluate by dialysis against Buffer C [20 mM Hepes - buffer pH 7,150 mM NaCl] (1:400). The sample was then concentrated (Amicon Ultra-15 - Centrifugal Filter; Merck) and purified by gel filtration in buffer C over a HiLoad 16/600 - Superdex 200 pg column.

    -

    Secreted IgG (G6, - G6des13) and Fab - (D44.1des) production - in suspension

    -

    Antibodies were expressed in - suspension-HEK293F cells, grown in FreeStyle medium (Gibco), in a shaking incubator (115 - rpm), at 37°C, in a controlled environment of 8% CO2. The variable regions of the - different heavy and light chains were cloned separately, upstream of IgG1 human Ab - scaffolds, into p3BNC plasmids. Transfections were done using linear 40 kDa - polyethyleneimine (PEI) (Polysciences) at 3 mg of PEI per 1 mg of plasmid DNA per 1 L of - culture, at a cell density of 1 million cells/ml. Growth media were collected after 5–7 days - and separated from cells by centrifugation at 600 x g. Media were then supplemented with - 0.02% (wt/vol) sodium azide and 0.1 mM PMSF and further clarified by centrifugation at - 16,840 x g for 30 min.

    -

    Fab production (D44.1, G6, G6des1, G6des13)

    -

    Adherent HEK293T cells were - cotransfected with genes encoding the light and heavy chain Fabs (heavy chain fused to - C-terminal His tag) in p3BNC plasmids using linear PEI as a transfection reagent (12.5 - μg/12.5 μg/50 μg, respectively, per 15-cm plate). Seventy-two hours post-transfection, the - medium containing the secreted protein was collected (~250 ml).

    + itemtype="http://schema.stenci.la/Emphasis">D = 15 nM (c & d) Thermal denaturation and + temperature of aggregation onset, respectively, of D44.1 and D44.1des formatted as Fabs using + microscale thermophoresis. (e) A potential molecular explanation + for improved affinity. The unbound (cyan) and bound (gray) structures of D44.1 (PDB entries: + 1MLB and 1MLC, respectively) exhibit a different H2 backbone conformation; the former + sterically hinders lysozyme binding. The high-affinity anti-lysozyme antibody F10.6.6 in its + unbound form (PDB entry: 2Q76; orange) and D44.1des (pink) are similar to one another + and to the bound conformation of D44.1 and are compatible with binding HEL. (inset) a + closeup of the H2 backbone conformation revealing that the D44.1 H2 backbone (cyan) + sterically overlaps with lysozyme, whereas all the other backbone conformations are + compatible with lysozyme binding. The Trp47HTyr mutation in D44.1des alters packing at + the base of CDR H2 and may induce the observed conformational change in the design.

    +
    +
    +

    We also compared the molecular + structure of D44.1des to + the unbound structure of D44.1 (PDB entry: 1MLB). The main difference between the two structures + was localized to the backbone conformation of CDR H2: Whereas H2 in the unbound structure of + D44.1 adopts a conformation that would sterically overlap with lysozyme in the bound structure, + the H2 backbone of D44.1des moves away from this position such + that, even in the unbound state, the design is sterically compatible with lysozyme binding. The + H2 backbone conformation of D44.1des is not identical but is similar to + the H2 conformation in the bound D44.1 structure and also to the conformation observed in the + unbound structure of the high-affinity anti-lysozyme antibody F10.6.6 (PDB entry: 1P2C) (Fig 2E). Although it is + possible that the observed conformational differences among the structures are due to + differences in crystallographic conditions, we note that the mutation Trp47HTyr in D44.1des is incompatible with the observed H2 + conformation in the unbound state of D44.1 and may induce the observed change in the design’s + backbone conformation. Hence, the structure-based analysis suggested that the design of the + vL-vH interface based on the bound antibody structure might increase the compatibility of the + CDR backbones for the ligand while simultaneously improving stability.

    +

    Computational mutation-tolerance mapping

    +

    The successful optimization of + antibody affinity and stability encouraged us to fully automate the design procedure, + eliminating the requirement for experimental deep mutational scanning. We, therefore, sought a + general computational strategy that would predict which mutations in the vL-vH interface were + likely to enhance affinity and stability, with the goal of developing a general computational + procedure for mutational-tolerance mapping. To achieve this goal, we exploited the large + experimental dataset of the D44.1 mutational tolerance map, comprising 2,294 point mutations, + for training. At each of the mutated D44.1 Fv positions, we used Rosetta to compute the changes + to native-state energy due to each of the 19 amino acid mutations (ΔΔG). Using a multiple-sequence alignment of + homologous Fvs, we additionally computed each point mutation’s evolutionary-conservation score, + as represented in a Position-Specific Scoring Matrix (PSSM) [38]. These + two computed parameters provide complementary predictions of mutational tolerance: the former + predicts the impact of a mutation on native-state stability and the latter discriminates between + evolutionarily tolerated mutations and those that have been purged by evolution. The use of + these two parameters has recently led to substantial improvement in design accuracy in binder + and enzyme design challenges in our laboratory [20–22,38–43]. We specifically used these two parameters + because they can be computed for any antibody given an accurate experimental or model structure, + allowing us, in principle, to compute mutational tolerance maps for any antibody Fv.

    +

    We systematically screened different + combinations of ΔΔG and PSSM + thresholds to determine which combination optimally discriminates enhancing from deleterious + mutations as observed in the experimental mutational-tolerance map of D44.1. We defined the + prediction true-positive rate (TPR) as the proportion of correctly predicted affinity-enhancing + mutations (>1.5-fold enrichment according to deep mutational scanning) and the true-negative + rate (TNR) as the proportion of correctly predicted deleterious ones (enrichment ratio <1). + The resulting phase space of (PSSM, ΔΔG) thresholds revealed an expected tradeoff, + wherein high TNR came at the cost of low TPR, and vice versa (Fig 3A). The likelihood of obtaining a + multipoint mutant without a single deleterious mutation can be roughly approximated by TNRn, where n is the number of mutations. Given the large + size of the vL-vH interface (20–30 positions [44]), we + aimed for a large maximum number of mutations in each multipoint mutant (n = 10) and therefore selected a stringent + cutoff TNR = 94%, providing a rough estimate that 50% of designs with ten mutations would not + contain a single deleterious mutation (Fig 3B). At this high TNR, the TPR is + only 40%, reflecting the challenging tradeoff in the design of multipoint variants. We + anticipate that in certain applications, such as in the design of improved antibodies for + therapeutic application, a smaller number of mutations may be preferred. In such cases, a lower + TNR and therefore a higher TPR may be implemented, and Fig 3C provides a guide for choosing + different (PSSM, ΔΔG) + thresholds. Instructions for computing a mutation-tolerance map based on any structure of an + antibody Fv are available as Supplemental Data, and the AbLIFT web server enables user control + of these parameters.

    +
    +

    Fab purification (D44.1, D44.1des, G6, G6des1, G6des13)

    -

    The filtered medium was - concentrated to ~200 ml using a diafiltration device (QuixStand Benchtop System; GE - Healthcare). The medium composition was exchanged to buffer A [50 mM Tris pH 8 and 150 mM - NaCl] using the same device. This was loaded on a HisTrap HP 5 ml column (GE Healthcare). - Washed with 15 bed volumes of 20 mM Tris pH 8, 150 mM NaCl and 10mM imidazole and was eluted - with 20 mM Tris pH 8, 150 mM NaCl and 250 mM imidazole. Imidazole was removed from the - eluate by dialysis against Buffer A (1:400). The sample was then concentrated (Amicon - Ultra-15 Centrifugal Filter; Merck) and purified by gel filtration in buffer A over a HiLoad - 16/600 Superdex 200 pg column.

    + id="mutational-tolerance-mapping-by-rosetta-atomistic-energy-calculations-δδg-and-evolutionary-conservation-scores-pssm"> + Mutational-tolerance mapping by Rosetta atomistic energy calculations (ΔΔG) and evolutionary-conservation scores + (PSSM). +

    (a) Systematic analysis of combinations + of PSSM and ΔΔG thresholds + reveals an expected tradeoff in prediction accuracy of mutational tolerance. Each + combination of thresholds (-10≤PSSM≤10; -10≤ΔΔG≤20 Rosetta energy units, R.e.u.) + results in a different fraction of correctly predicted enhancing or deleterious mutations + (true-positive rate [TPR] and true-negative rate [TNR], respectively) observed in the deep + mutational scanning data of D44.1. (b) All (PSSM, ΔΔG) combinations are plotted with their + TPR and TNR values, and the Pareto-optimal front is indicated in orange. Several + combinations of (PSSM, ΔΔG) thresholds are indicated by blue + triangles. (c) The + thresholds (PSSM≥-1, ΔΔG≤+1 R.e.u.) result in a TNR of 94% and + TPR of 40% and were used in subsequent design calculations. Optimal ΔΔG cutoffs may vary depending on the + energy function and the relaxation protocol. For details on these choices, see Methods.

    +
    +
    +

    Automated affinity and + stability design in the vL-vH interface

    +

    We next sought to develop a general + and fully automated design protocol for improving molecular interactions across the vL-vH + interface. AbLIFT starts by computing a mutational-tolerance map at the vL-vH interface using + the approach described above; it then exhaustively enumerates the multipoint combinations of + tolerated mutations; ranks them by energy, and selects low-energy variants for experimental + testing. This algorithm resembles our recently described FuncLib method for designing + functionally diverse enzyme repertoires [41], with + the key differences that AbLIFT is applied to the core of obligatory binding surfaces rather + than to solvent-exposed surfaces and most importantly, AbLIFT does not require an initial design + round of protein stabilization.

    +

    To validate AbLIFT, we chose two + antibodies as subjects for design: the synthetic antibody G6, which targets human + Vascular-Endothelial Growth Factor (VEGF) [45], and an + engineered variant of the 492.1 antibody, designated h492.1, which targets human Quiescin + Sulfhydryl Oxidase 1 (QSOX1). QSOX1 is a multi-domain disulfide-catalyst that is overproduced in + tumors [46] and is a potential drug target [47,48]. These + antibodies are unrelated to D44.1 or to one another and are the products of protein engineering. + G6 is widely used in animal studies and resulted from a phage-displayed synthetic Fab library of + the light chain with a heavy chain sequence of an anti-mVEGF antibody (KD approximately 1 nM) [49]. The h492.1 antibody was obtained by fusing the + variable domains from the high-affinity (KD approximately 1 nM) + QSOX1-inhibiting murine antibody 492.1 onto a human IgG scaffold. Following this fusion, h492.1 + could not be expressed to detectable levels in a recombinant cultured human cell system, + frustrating its further development. Thus, with these two targets, we sought to test the ability + of AbLIFT to optimize high-affinity antibodies that resulted from conventional + antibody-engineering procedures, whether well-behaved ones (G6) or ones that showed low (or no) + detectable expression levels (h492.1).

    +

    The computed mutational-tolerance map + of G6 (starting from its bound structure, PDB entry 2FJG) at 30 vL-vH interface positions + defined 26 affinity-enhancing mutations at 11 positions. To achieve significant improvement of + vL-vH interface packing, we sought to design multipoint mutants with 4–10 mutations relative to + G6, resulting in a tolerated sequence space of 203,835 unique multipoint mutants. All multipoint + mutants were modeled in Rosetta, including by a backbone and side-chain minimization step, which + is essential for enabling cavity-filling small-to-large mutations [50,51], and the models were then ranked by energy. 53% + of the mutants (>100,000) exhibited energies as favorable as or better than the G6-bound + antibody. Therefore, although the exhaustive enumeration of this large number of mutants is + computationally demanding (approximately 6,000-CPU hours), the very large number of potentially + improved designs makes a compelling case for exhaustive enumeration and ranking of variants + within the tolerated sequence space. Furthermore, the computed mutational-tolerance map focuses + exhaustive enumeration on a subset of stable multipoint mutants within the vast hypothetical + sequence space of mutants at the vL-vH interface (2030 = 1039 unique sequences), >99% of which + are predicted to have reduced stability compared to the parental antibody (S3 Fig).

    +

    We clustered the designs, eliminating + ones that had fewer than four mutations relative to one another and selected the 18 + lowest-energy ones for experimental testing. The designs were formatted as scFvs, and their + binding signals relative to the G6 antibody were first qualitatively measured at 8 nM VEGF + concentration using yeast display [3] (Fig 4A). Encouragingly, seven designs + (approximately 40%) showed comparable or higher binding signal at this concentration. The best + two designs, G6des1 and + G6des13, were expressed + as Fabs. When subjected to Ni-NTA purification, G6 exhibited multiple bands, indicative of + sample heterogeneity, whereas, remarkably, both designs eluted mostly in the size expected for a + Fab (S4A and S4B Fig) [52].

    +
    +

    Apparent TFully + automated antibody stability and affinity optimization using AbLIFT.

    +

    (a) G6 and 18 low-energy designs, each + encoding 4–10 mutations relative to G6 (number of mutations is indicated above the bars) + were tested for binding using yeast display at 8 nM VEGF concentration, resulting in seven + designs that showed comparable or higher binding signal compared to G6. G6des1 and G6des13 were chosen for further + characterization (colored in blue and orange, respectively). (b) SPR kinetic analysis of VEGF binding + with twofold dilutions from a maximal concentration of 100 nM by G6, G6des1, and G6des13 Fabs demonstrated faster + binding on-rate in the designs (km and aggregation onset - measurements -

    The apparent melting temperature - of the antibodies was determined by Prometheus NT. Plex instrument (NanoTemper - Technologies), a label-free method. Fabs obtained from secreted Fab production in adherent - cells (D44.1, G6, G6des1, G6des13) and from production in - suspension (D44.1des) - were diluted to 0.2 mg/ml (in 20 mM Hepes pH 7 and 50mM NaCl for anti-lysozyme antibodies - and in 20 mM Hepes pH 7.5, 150 mM NaCl for anti VEGF antibodies). The temperature was ramped - from 25°C to 100°C at 0.05°C/s, and both Ta = 2.3 * 105 M-1s-1, 3.27 * 105 M-1s-1 and 5.3 * 105 M-1s-1, respectively). G6des13 also improved + binding off-rate (kd = 3.2 * 10−5 s-1 compared to 6 * 10−5 s-1 in G6), resulting in an improved + dissociation constant (Km and aggregation-onset - temperature were measured.

    -

    - Surface-plasmon resonance

    -

    Surface plasmon resonance - experiments on the anti-lysozyme (D44.1 and D44.1des expressed in bacteria) and - anti-VEGF antibodies (G6, G6des1 and G6des13 expressed in adherent cells) - were carried out on a Biacore T200 instrument (GE Healthcare) at 25°C with HBS-N EP+ [10 mM - Hepes, 150 mM NaCl, 3 mM EDTA, 0.005% vol/vol surfactant P20 (pH 7.4)]. For binding - analysis, 1,000–1,600 response units (RU) of Fab were captured on a CM5 sensor chip. Samples - of different protein concentrations were injected over the surface at a flow rate of 30 - μL/min for 240 s, and the chip was washed with buffer for 2,000 s. If necessary, surface - regeneration was performed with 30 s injection of 50 mM NaOH (D44.1des) or 10 mM NaOH (VEGF antibodies) - at a flow rate of 30 μL/min. One flow cell contained no ligand and was used as a reference. - The acquired data were analyzed using the device’s software, and kinetic fits were - performed.

    + itemtype="http://schema.stenci.la/Emphasis">D = 60 pM compared to 270 pM in + G6). (c & d) + Thermal denaturation and temperature of aggregation onset experiments, respectively, using + microscale thermophoresis indicated substantially higher apparent stability in the designs. + (e) Computational + mutation-tolerance mapping indicated 11 positions at the vL-vH interface of the anti-VEGF + antibody G6 (spheres) with potentially tolerated mutations. Thumbnails indicate selected + mutations in a model structure of G6des13 relative to G6 (gray). (f) Expression levels in + HEK293 cells of G6 and the designs formatted as IgG were measured using Western blot + analysis showing approximately an order of magnitude improvement in IgG expression levels + for the designs. (g) + Native mass-spectrometry analysis exhibited higher tolerance to applied collision energy in + G6des13 compared to + G6, both formatted as IgG. The error bars represent standard deviations inferred from three + repeats.

    +
    +
    +

    Next, the designs’ affinities for + VEGF were determined using SPR (Fig 4B). Both designs improved binding + on-rate, and G6des13 also + improved the off-rate, resulting in fivefold improvement in KD relative to G6. Both designs also + exhibited substantial improvements in thermal stability and the temperature of aggregation onset + (19° C and 10° C, respectively) (Fig 4C and 4D). We examined the model + structure of G6des13, + which comprised six mutations at the vL-vH interface relative to G6, finding that the mutations + were likely to improve the interface through backbone rigidification and the introduction of a + new buried polar hydrogen-bond network (Fig 4E). Such cooperative interaction + networks do not typically arise in conventional antibody affinity-maturation processes (either + in nature or the laboratory), which select mutations in a stepwise manner and are therefore + biased towards additive rather than cooperative multipoint mutations. Introducing accurate new + polar interaction networks is also a fundamental challenge for computational design [53,54] and the + use of evolutionary constraints during design has recently been shown to overcome this challenge + [42].

    +

    We next tested the stability and + expressibility of the VEGF designs formatted as full-length IgGs. We expressed G6, G6des1, and G6des13 in HEK293 cells and + found that the designs exhibited nearly an order of magnitude higher expression level than G6 + (Fig 4F). We next measured + the relative stabilities of G6 and G6des13 using native mass spectrometry + [55] under reducing conditions by titrating the + collision energy (Fig + 4G). We found that G6 IgG disassembly started at lower collision energy + compared to G6des13, + indicative of the design’s higher stability (S5 Fig). We, therefore, concluded that + AbLIFT could substantially improve expressibility, stability, and affinity, regardless of + whether the antibody was formatted as Fab or IgG.

    +

    We applied the same computational + strategy to h492.1, in which the Fv was derived from a murine antibody and the constant regions + were derived from human IgG1. Since h492.1 failed to show detectable expression in HEK293 cell + cultures, we started the computational design from the structure of the murine 492.1 parental + antibody in complex with QSOX1 (PDB entry: 4IJ3) [47]. We + selected the 20 lowest-energy, sequence-clustered AbLIFT designs, fused them to human IgG1 + constant domains and subjected them to HEK293-expression screening from crude cell lysate + supernatant. Dot-blot analysis showed detectable expression levels for all 20 designs, in clear + contrast with the lack of detectable expression for h492.1 (Fig 5A). We further quantitated + expression levels using Western blot, revealing substantial variation in the expression levels + among the designs (Fig + 5B). In parallel, we examined the levels of QSOX1 inhibition by the 20 designs, + finding that 50% showed high levels of QSOX1 inhibition (S6 Fig). Based on activities and + expression levels, we selected h492.1des3 and h492.1des18 for further analysis. These designs + were purified and added to QSOX1 activity assays to test for inhibition. h492.1des18 showed comparable inhibitory levels + to the murine parent antibody when provided at equimolar amounts to a typical physiological + concentration of QSOX1 (25 nM) as found in human serum (Fig 5C) [56]. This + analysis demonstrated that h492.1des18 almost completely recovered the + activity of the parental antibody while gaining high expression levels (approximately 75 mg/L + supernatant). Structural analysis indicated that this design improved packing at the vL-vH + interface (Fig + 5D), demonstrating that in some cases optimizing this region could have a + dramatic effect on the expression levels of engineered antibodies.

    +
    +

    IgG Western blot analysis (G6, G6des1, G6des13)

    -

    HEK293T cells were seeded on a - 24-well plate pre-coated with poly-L-lysine at 120,000 cells/well. The next day, cells were - transfected with 1 μg DNA mixture consisting of 200 ng pLXN plasmid encoding Luciferase, 400 - ng of a plasmid encoding the light chains and 400 ng of a plasmid encoding the heavy chains - of the designated antibodies. Each transfection was carried in 100 μl DMEM in which 2 μg of - linear 40,000 Da PEI (Polysciences) per μg of DNA were mixed. The transfection mixture was - added to cells, for a total volume of 400 μl DMEM per well. 4 hours after transfection, - cells were washed and fresh 1 ml DMEM with 1% penicillin and streptomycin, glutamine and - non-essential amino acids was applied. 72 hours post-transfection supernatant was separated - from cells and the cells were resuspended in 500 μl PBS. A sample of 100 μl from the - suspended cells from each well was transferred to 96-well white plates (Nunc) with 100 μl of - Bright-Glo reagent (Promega) to quantify the level of luciferase as a proxy for the - transfection efficiency. Adjusted volumes of supernatants based on the luciferase levels - were loaded on a gradient gel (Bio-Rad) and run according to manufacturer's - instructions. Semi-dry blotting was performed to a nitrocellulose membrane followed by - blocking in 5% milk powder in TBST (0.1% Tween 20, 20 mM Tris pH 8.0, 150 mM sodium - chloride) buffer for 30 min at room temperature. Donkey anti-human IgG conjugated to HRP - (Abcam) was used to detect the human IgG scaffold for 1 h at room temperature.

    -

    Mass spectrometry sample preparation

    -

    Following IgG production in - suspension (as described above), clarified media were aliquoted, snap frozen in liquid - nitrogen and stored at -80°C. On the day of the measurements, samples were thawed and buffer - exchanged into 1 M ammonium acetate, pH 7, using Micro Bio-Spin 6 Columns (Bio-Rad). To - break all disulfide bonds, antibodies were then reduced for 4 h at 37°C in the presence of - 20 mM TCEP, followed by two consecutive buffer exchanges into 1 M and 150 mM ammonium - acetate, respectively.

    -

    - Native-mass spectrometry

    -

    Nanoelectrospray ionization - (nano-ESI) MS experiments were performed on a modified Q-Exactive Plus Orbitrap EMR (Thermo - Fisher Scientific, Bremen, Germany) [70]. All - spectra are shown without smoothing. The instrument was calibrated externally, using cesium - iodide. Typically, an aliquot of 2 μl protein solution was loaded into a gold-coated - nano-ESI capillary prepared in-house, as previously described [71], and - sprayed into the instrument. Conditions within the mass spectrometer were adjusted to - preserve noncovalent interactions. The source was operated in positive mode, the capillary - voltage was set to 1.7 kV, the capillary temperature was 180°C and argon was used as the - collision gas in the higher-energy collision-induced dissociation (HCD) cell. MS spectra - were recorded at a resolution of 10,000 and HCD voltage was set to 50 V, at trapping gas - pressure setting of 3.9, which corresponds to HV pressure of 1.04 x 10−4 mbar and UHV pressure of 2.35 x - 10−10 mbar. Bent - flatapole DC bias and axial gradient were set to 2 V and 25 V, respectively.

    -

    - Gas-phase stability assay

    -

    Antibody stability was monitored - by tandem MS (MS/MS), at different HCD voltages. The 23+ charge state of the G6 and G6des13 antibodies was - isolated in the quadrupole, with an isolation window of 20 m/z, and the transmitted ions - were subjected to collision-induced dissociation in the HCD cell, at a gradient of - accelerating voltages ranging between 50–200 V. The relative abundance of the full IgG’s and - the dissociated light chains, recorded at the different HCD voltages, was determined by - measuring their peak heights. The total intensity of the light chains was calculated as the - sum of intensities of their corresponding charge states. In each experimental condition, the - total intensities of all the measured species were summed and referenced as 100% intensity. - The relative intensity of each species was then calculated as a percentage of the total - intensity. The stability assay was performed six times. Error bars represent standard - deviation.

    -

    Anti-QSOX1 antibody production

    -

    The coding sequences for variable - domains of antibody 492.1 were fused to human antibody constant regions [72]. - Mutations were introduced by site-directed mutagenesis into the resulting hybrid antibody - expression plasmids according to published procedures [73]. - Plasmids were transfected into suspension-adapted suspension-HEK 293F cells. The day before - transfection, cells were split to 0.7 x 106 cells/ml. For parallel expression - of the parent hybrid antibody and the 20 variants, transfections were performed using 0.5 μg - of each plasmid (heavy and light Ab chains) mixed with 3 μg PEI Max reagent (Polysciences - Inc.) and incubated 20 min in 24-well tissue culture trays prior to addition of 1 ml cells - per well. Plates were then agitated vigorously in a tissue culture incubator/shaker to - prevent cell settling. After 4 days, cultures were transferred to microfuge tubes, and cells - were pelleted by centrifugation at 500 x g for 10 min. Supernatants were transferred to - fresh microfuge tubes, from which aliquots were taken for quantification of antibody - expression and activity. For purification of selected Ab designs, transfections were done in - 40 ml volumes, and plasmid and PEI Max amounts were scaled up accordingly. Cultures were - grown for 6 days, and Ab was purified from the supernatant by protein G affinity - chromatography (GE Healthcare).

    -

    QSOX1 dot blot and Western blot assays

    -

    Relative antibody concentrations - were determined from culture supernatants by dot and Western blotting. Blotting was - conducted in triplicate for each of two biological replicates. For dot blots, 2 μl of each - supernatant was spotted onto nitrocellulose membranes. Membranes were then covered with a - blocking solution of PBS containing 0.1% Tween (PBS-T) and 5% bovine serum albumin (BSA) and - gently agitated for 1 h at room temperature. For western blots, 10 μl of each supernatant - was applied with non-reducing gel loading buffer to 10% SDS polyacrylamide gels. After - electrophoresis, proteins were transferred to nitrocellulose, and the membranes were - incubated in PBS-T with 5% BSA under gentle agitation. For both dot and Western blots, - horseradish peroxidase-conjugated antibody recognizing human Fc was added to the blocking - solution after the first hour, and incubation/shaking was continued for another 45 min. The - membrane was then washed three times for 5 min each with PBS-T, and the blot was developed - using SuperSignal West Pico (ThermoFisher) chemiluminescent substrate. Dot and band - intensities were recorded on a ChemiDoc XRS+ system (Bio-Rad).

    -

    QSOX1 - inhibition assays

    -

    QSOX1 inhibition assays were - conducted by using 5,5-dithio-bis-2-nitrobenzoic acid (DTNB) to quantify the remaining - dithiothreitol (DTT) after incubation with purified recombinant QSOX1 and HEK293 culture - supernatants or purified antibody. Culture supernatants (25 μl) were mixed in a clear, - flat-bottom, 96-well plate with 12.5 μl of 40 nM QSOX1, and reactions were initiated by - injection of 12.5 μl 600 μM DTT (final concentrations 10 nM QSOX1 and 150 μM DTT). Reactions - were stopped after 30 min by adding 150 μl 500 μM DTNB, and absorbance at 412 nm was - measured after 5 min in a Tecan microplate reader.

    -

    Purified antibody variants were - quantified by absorbance at 280 nm after dilution into 6 M guanidine dissolved in PBS, using - an extinction coefficient of 187,000 M-1cm-1. Purified antibodies (12.5 μl) at - concentrations of 40 nM, 100 nM, and 200 nM were mixed in a 96-well plate with 12.5 μl 100 - nM QSOX1, and reactions were initiated by injection of 25 μl 600 μM DTT (final - concentrations 25 nM QSOX1, 300 μM DTT, and 10, 25, or 50 nM antibody). Reactions were - stopped after 20 min by adding 150 μl 500 μM DTNB, and absorbance at 412 nm was measured - after 5 min. Background-subtracted absorbance readings were normalized relative to the - uninhibited and fully inhibited reactions (the latter mimicked by leaving QSOX1 out of the - reaction), and results were plotted in Fig 5C as the relative inhibitory activity. -

    -

    - Supporting information

    S1 Fig

    -

    a. Mutational tolerance mapping of the - anti-lysozyme antibody D44.1. Mutations that were enriched, depleted, or had - insufficient data in deep sequencing are marked in blue, red, and gray respectively. Wild - type amino acids are indicated in one-letter codes for each position. Disulfide-bonded - cysteines are marked in black triangles, and light-heavy chain interface positions in which - point mutations exhibited over threefold enrichment relative to wild type, are marked in - pink triangles. b. - Qualitative binding titrations using yeast display for D44.1, D44.1des, and seven point mutants that - comprise D44.1des using yeast surface display. Binding fluorescence intensities are relative - to the highest concentration of 1 μM lysozyme.

    -

    (TIF)

    S2 Fig

    -

    a. The crystal structure of D44.1des (yellow and green - for heavy and light chains, respectively) shows high accuracy relative to the computational - design (lavender). Electron density at 2 σ. b. Crystallographic analysis of - D44.1des shows high - agreement with D44.1 (0.7 Å Cα root-mean-square deviation), including in the orientations of - binding-surface residues (sticks; D44.1 in gray).

    -

    (TIF)

    S3 Fig

    Computational - mutation tolerance mapping enriches for low-energy designs.

    -

    (blue) the distribution of - Rosetta energies relative to G6 of a selection of >150,000 unique multipoint mutants at - 11 positions encoded in the tolerated sequence space computed by PSSM (≥-1) and ΔΔG (≤+1 R.e.u.) filters. - (green) a random set of multipoint mutants at 30 vL-vH interface (all interface positions - were allowed), where any of the 19 amino acid mutations was allowed at each mutated - position. In both sets, the same number of multipoint mutants was analyzed, and the same - distribution of the number of mutations relative to G6 was implemented. 37% of the - multipoint mutants had energies that were more favorable than G6, whereas less than 0.03% of - the random mutants had more favorable energies than G6. Thus computational mutation - tolerance mapping enriches for improved mutants by over 1,100-fold relative to random - multipoint mutations.

    -

    (TIF)

    S4 Fig

    G6, G6des1, and G6des13 Fab expression and - purification.

    -

    (a) Following Ni-NTA - purification, G6 exhibits the expected band at 50 kDa, and additional bands at approximately - 100 kDa, indicative of sample heterogeneity. G6des13 and G6des1, by contrast, primarily elute at - the 50 kDa size range with no detectable higher-mass bands. (b) Designs G6des13 and G6des1 after gel filtration run at - their expected sizes. The status of reducing conditions (without DTT and boiling) is - indicated at the bottom of the gels.

    -

    (TIF)

    S5 Fig

    - Secreted full-length IgG1 G6 and G6des13 antibodies were reduced and - analyzed by native mass-spec directly from the growth medium.

    -

    Upper panels show the full - spectra. Charge state series of the two antibodies are labeled by dark blue and light blue - circles, respectively. The +23 charge state of each antibody was isolated in the quadrupole - and subjected to a gradual elevation of collision voltage in a stepwise manner, ranging from - 50 to 200 V. Light chains, which gradually dissociated from the intact antibodies, are - labeled the by red and orange circles.

    -

    (TIF)

    S6 Fig

    - All 20 h492.1 designs were expressed, and their activities from culture supernatants were - measured as described in the methods.

    -

    The highest values in the blot - reflect the greatest amounts of substrate remaining at the end of a QSOX1 sulfhydryl oxidase - activity assay, indicating the greatest inhibition of QSOX1 by the antibody. Due to - differences in expression levels (Fig 5A and 5B), inhibitory activity in this - experiment reflects a combination of expression yield and intrinsic activity. The designs - with results plotted in color (yellow and pink) were expressed in larger volumes, purified, - and compared quantitatively for inhibitory activity compared to the parental 492.1 antibody - purified from a hybridoma (Fig 5C).

    -

    (TIF)

    S1 Table

    Data collection and - refinement statistics for D44.1des, PDB code 6GC2.

    -

    (XLSX)

    S2 Table

    - The mutated positions and identities in G6 designs, colored according to their - physicochemical properties and sorted by normalized fluorescence value (measured by yeast - display experiments).

    -

    (DOCX)

    S3 Table

    - The mutated positions and identities in anti-QSOX1 492.1 designs, colored according to their - physicochemical properties.

    -

    (DOCX)

    S4 Table

    - Log-enrichment of the deep mutational scanning data of anti-lysozyme antibody D44.

    -

    Data retrieved from the deep - mutational scanning analysis of enrichment over WT for single point substitutions.

    -

    (XLSX)

    S1 Protocol

    RosettaScript for - refinement of structures retrieved from the PDB.

    -

    (TXT)

    S2 Protocol

    RosettaScript for single-point - mutational scanning.

    -

    (TXT)

    S3 Protocol

    RosettaScript for combinatorial - sequence design.

    -

    An example of a protocol for - designing a specific combinatorial mutant.

    -

    (TXT)

    S1 Text

    DNA - sequences of tested constructs.

    -

    (DOCX)

    S2 Text

    - Amino acid sequences of G6 and G6des13 IgGs.

    -

    Protein sequences used in the - mass spectrometry analyses.

    -

    (DOCX)

    -
    -

    References

    -
      -
    1. -
      - -
      - -
      -
      Affinity Maturation Increases the Stability and - Plasticity of the Fv Domain of Anti-protein Antibodies - -
        - - - - - -
      - -
      2. -
    2. -
      - -
      - -
      -
      - - Developability assessment in pharmaceutical industry: An integrated group approach for - selecting developable candidates - -
        - - - - -
      - -
      3. -
    3. -
      - -
      - -
      -
      Isolating and engineering human antibodies using yeast - surface display - -
        - - - - - - -
      - -
      4. -
    4. -
      - -
      - -
      -
      Directed evolution of antibody fragments with monovalent - femtomolar antigen-binding affinity - -
        - - - -
      - -
      5. -
    5. -
      - -
      - -
      -
      Substantial energetic improvement with minimal - structural perturbation in a high affinity mutant antibody - -
        - - - - - - -
      - -
      6. -
    6. -
      - -
      - -
      -
      - - Efficient affinity maturation of antibody variable domains requires co-selection of - compensatory mutations to maintain thermodynamic stability - -
        - - - - - -
      - -
      7. -
    7. -
      - -
      - -
      -
      High affinity, developability and functional size: The - holy grail of combinatorial antibody library generation - -
        - - - - -
      - -
      8. -
    8. -
      - -
      - -
      -
      Protein aggregation and bioprocessing - -
        - - - -
      - -
      9. -
    9. -
      - -
      - -
      -
      Effects of protein aggregates: an immunologic - perspective - -
        - -
      - -
      10. -
    10. -
      - -
      - -
      -
      - - Developability studies before initiation of process development: improving - manufacturability of monoclonal antibodies - -
        - - - - - - -
      - -
      11. -
    11. -
      - -
      - -
      -
      Strategies and challenges for the next generation of - therapeutic antibodies - -
        - - - - -
      - -
      12. -
    12. -
      - -
      - -
      -
      Computational design of antibody-affinity improvement - beyond in vivo maturation - -
        - - - -
      - -
      13. -
    13. -
      - -
      - -
      -
      Design of therapeutic proteins with enhanced - stability - -
        - - - - - -
      - -
      14. -
    14. -
      - -
      - -
      -
      Biophysical properties of the clinical-stage antibody - landscape - -
        - - - - - - -
      - -
      15. -
    15. -
      - -
      - -
      -
      Boosting antibody developability through rational - sequence optimization - -
        - - - - - - -
      - -
      16. -
    16. -
      - -
      - -
      -
      General strategy for the generation of human antibody - variable domains with increased aggregation resistance - -
        - - - - - - -
      - -
      17. -
    17. -
      - -
      - -
      -
      Structure-based design of supercharged, highly - thermoresistant antibodies - -
        - - - - - - -
      - -
      18. -
    18. -
      - -
      - -
      -
      Aggregation-resistant domain antibodies selected on - phage by heat denaturation - -
        - - - - -
      - -
      19. -
    19. -
      - -
      - -
      -
      Structural mechanism for affinity maturation of an - anti-lysozyme antibody - -
        - - - -
      - -
      20. -
    20. -
      - -
      - -
      -
      Automated Structure-and Sequence-Based Design of - Proteins for High Bacterial Expression and Stability - -
        - - - - - - -
      - -
      21. -
    21. -
      - -
      - -
      -
      Principles of Protein Stability and Their Application in - Computational Design - -
        - - -
      - -
      22. -
    22. -
      - -
      - -
      -
      One-step design of a stable variant of the malaria - invasion protein RH5 for use as a vaccine immunogen - -
        - - - - - - -
      - -
      23. -
    23. -
      - -
      - -
      -
      Automated selection of stabilizing mutations in designed - and natural proteins - -
        - - -
      - -
      24. -
    24. -
      - -
      - -
      -
      Optimization of affinity, specificity and function of - designed influenza inhibitors using deep sequencing - -
        - - - - - - -
      - -
      25. -
    25. -
      - -
      - -
      -
      Deep mutational scanning: a new style of protein - science - -
        - - -
      - -
      26. -
    26. -
      - -
      - -
      -
      High-resolution mapping of protein sequence-function - relationships - -
        - - - - - - -
      - -
      27. -
    27. -
      - -
      - -
      -
      - - Mutational landscape of antibody variable domains reveals a switch modulating the - interdomain conformational dynamics and antigen binding - -
        - - - - - - -
      - -
      28. -
    28. -
      - -
      - -
      -
      - - Deep mutational scanning of an antibody against epidermal growth factor receptor using - mammalian cell display and massively parallel pyrosequencing - -
        - - - - - - -
      - -
      29. -
    29. -
      - -
      - -
      -
      Robust in vitro affinity maturation strategy based on - interface-focused high-throughput mutational scanning - -
        - - - - - - -
      - -
      30. -
    30. -
      - -
      - -
      -
      Measuring the sequence-affinity landscape of antibodies - with massively parallel titration curves - -
        - - - - -
      - -
      31. -
    31. -
      - -
      - -
      -
      Saturation scanning of ubiquitin variants reveals a - common hot spot for binding to USP2 and USP21 - -
        - - - - -
      - -
      32. -
    32. -
      - -
      - -
      -
      Computational design of novel protein binders and - experimental affinity maturation - -
        - - - -
      - -
      33. -
    33. -
      - -
      - -
      -
      - - Three-dimensional structures of the free and the antigen-complexed Fab from monoclonal - anti-lysozyme antibody D44.1 - -
        - - - - - - -
      - -
      34. -
    34. -
      - -
      - -
      -
      Structure of antibody-antigen complexes: implications - for immune recognition - -
        - -
      - -
      35. -
    35. -
      - -
      - -
      -
      Antibody evolution constrains conformational - heterogeneity by tailoring protein dynamics - -
        - - - - - - -
      - -
      36. -
    36. -
      - -
      - -
      -
      Trends in antibody sequence changes during the somatic - hypermutation process - -
        - - - - -
      - -
      37. -
    37. -
      - -
      - -
      -
      Humanised antibodies - -
        - - - -
      - -
      38. -
    38. -
      - -
      - -
      -
      AbDesign: An algorithm for combinatorial backbone design - guided by natural conformations and sequences - -
        - - - - - - -
      - -
      39. -
    39. -
      - -
      - -
      -
      Principles for computational design of binding - antibodies - -
        - - - - - - -
      - -
      40. -
    40. -
      - -
      - -
      -
      Highly active enzymes by automated combinatorial - backbone assembly and sequence design - -
        - - - - - - -
      - -
      41. -
    41. -
      - -
      - -
      -
      Automated Design of Efficient and Functionally Diverse - Enzyme Repertoires - -
        - - - - - - -
      - -
      42. -
    42. -
      - -
      - -
      -
      Ultrahigh specificity in a network of computationally - designed protein-interaction pairs - -
        - - - - - - -
      - -
      43. -
    43. -
      - -
      - -
      -
      Why reinvent the wheel? Building new proteins based on - ready-made parts - -
        - - -
      - -
      44. -
    44. -
      - -
      - -
      -
      Analysis and prediction of VH/VL packing in - antibodies - -
        - - -
      - -
      45. -
    45. -
      - -
      - -
      -
      - - Structure-Function Studies of Two Synthetic Anti-vascular Endothelial Growth Factor - Fabs and Comparison with the Avastin Fab - -
        - - - - - - -
      - -
      46. -
    46. -
      - -
      - -
      -
      Loss of Nkx3.1 leads to the activation of discrete - downstream target genes during prostate tumorigenesis - -
        - - - - - - -
      - -
      47. -
    47. -
      - -
      - -
      -
      An inhibitory antibody blocks the first step in the - dithiol/disulfide relay mechanism of the enzyme QSOX1 - -
        - - - - -
      - -
      48. -
    48. -
      - -
      - -
      -
      The dynamic disulphide relay of quiescin sulphydryl - oxidase - -
        - - - - - - -
      - -
      49. -
    49. -
      - -
      - -
      -
      High-affinity human antibodies from phage-displayed - synthetic Fab libraries with a single framework scaffold - -
        - - - - - - -
      - -
      50. -
    50. -
      - -
      - -
      -
      Role of conformational sampling in computing - mutation-induced changes in protein structure and stability - -
        - - - -
      - -
      51. -
    51. -
      - -
      - -
      -
      Eris: an automated estimator of protein stability - -
        - - - -
      - -
      52. -
    52. -
      - -
      - -
      -
      Developability assessment during the selection of novel - therapeutic antibodies - -
        - - - - - - -
      - -
      53. -
    53. -
      - -
      - -
      -
      De novo design of protein homo-oligomers with modular - hydrogen-bond network-mediated specificity - -
        - - - - - - -
      - -
      54. -
    54. -
      - -
      - -
      -
      Inspired by nature: designed proteins have structural - features resembling those of natural active sites - -
        - - -
      - -
      55. -
    55. -
      - -
      - -
      -
      - -
        - - - - - - -
      -
      56. -
    56. -
      - -
      - -
      -
      Disulfide bond generation in mammalian blood serum: - detection and purification of quiescin-sulfhydryl oxidase - -
        - - - - -
      - -
      57. -
    57. -
      - -
      - -
      -
      The association of heavy and light chain variable - domains in antibodies: implications for antigen specificity - -
        - - - -
      - -
      58. -
    58. -
      - -
      - -
      -
      Second antibody modeling assessment (AMA-II) - -
        - - - - - - -
      - -
      59. -
    59. -
      - -
      - -
      -
      - - High-accuracy modeling of antibody structures by a search for minimum-energy - recombination of backbone fragments - -
        - - - -
      - -
      60. -
    60. -
      - -
      - -
      -
      AbPredict 2: a server for accurate and unstrained - structure prediction of antibody variable domains - -
        - - - - -
      - -
      61. -
    61. -
      - -
      - -
      -
      Structural evidence for induced fit as a mechanism for - antibody-antigen recognition - -
        - - - -
      - -
      62. -
    62. -
      - -
      - -
      -
      A theory of the structure and process of formation of - antibodies - -
        - -
      - -
      63. -
    63. -
      - -
      - -
      -
      Major antigen-induced domain rearrangements in an - antibody - -
        - - - - - -
      - -
      64. -
    64. -
      - -
      - -
      -
      - - Mutational scanning reveals the determinants of protein insertion and association - energetics in the plasma membrane - -
        - - - - - - -
      - -
      65. -
    65. -
      - -
      - -
      -
      An efficient one-step site-directed deletion, insertion, - single and multiple-site plasmid mutagenesis protocol - -
        - - -
      - -
      66. -
    66. -
      - -
      - -
      -
      - - Frozen competent yeast cells that can be transformed with high efficiency using the - LiAc/SS carrier DNA/PEG method - -
        - - -
      - -
      67. -
    67. -
      - -
      - -
      -
      RosettaScripts: a scripting language interface to the - Rosetta macromolecular modeling suite - -
        - - - - - - -
      - -
      68. -
    68. -
      - -
      - -
      -
      Combined covalent-electrostatic model of hydrogen - bonding improves structure prediction with Rosetta - -
        - - - - - - -
      - -
      69. -
    69. -
      - -
      - -
      -
      Simultaneous Optimization of Biomolecular Energy - Functions on Features from Small Molecules and Macromolecules - -
        - - - - - - -
      - -
      70. -
    70. -
      - -
      - -
      -
      Triple-Stage Mass Spectrometry Unravels the - Heterogeneity of an Endogenous Protein Complex - -
        - - - - - - -
      - -
      71. -
    71. -
      - -
      - -
      -
      Analyzing large protein complexes by structural mass - spectrometry - -
        - - - -
      - -
      72. -
    72. -
      - -
      - -
      -
      - - Efficient generation of monoclonal antibodies from single human B cells by single cell - RT-PCR and expression vector cloning - -
        - - - - - - -
      - -
      73. -
    73. -
      - -
      - -
      -
      Applications of the Restriction Free (RF) cloning - procedure for molecular manipulations and protein expression - -
        - - - - - -
      - -
      74. + id="substantial-increase-in-antibody-expression-yields-following-ablift-design">Substantial + increase in antibody expression yields following AbLIFT design. +

      (a) Dot blot analysis showed no + detectable expression for h492.1 in HEK293 cells, whereas all 20 designs showed detectable + levels of expression. (b) Relative expression levels of the 20 + designs using Western blot analysis. h492.1des3 and h492.1des18 showed high expression and were + selected for further analysis. (c) QSOX1 inhibitory activity assay + using the parental 492.1 antibody and two designs. The inhibitory activity was measured for + each antibody in a sulfhydryl oxidase assay using a physiological concentration of QSOX1 (25 + nM). h492.1des18 + showed comparable inhibitory activity relative to the parental antibody, with only a slight + decrease when provided at sub-stoichiometric amounts (10 nM). (d) The structural context of mutations + in h492.1des18 + (color) relative to the experimental structure of 492.1 (gray). Spheres indicate the + locations of the mutations, and the thumbnail shows two of the four designed mutations, + which improve interchain packing and rigidify the backbone at the vL-vH interface according + to the model structure.

      +
    +
    +

    Finally, we asked whether there were + any sequence features in common among the designs (S3 and S4 Tables). Strikingly, position 43L (Chothia numbering) was + mutated to Pro in D44.1des and in >60% of the G6 and h492.1 + designs. Position 43L is + located in a tight turn that connects two neighboring β strands, away from the CDRs, but Pro is + not the consensus identity at this position (Ala and Ser are preferred). Furthermore, mutations + at this position may have an important effect on the rigid-body angle formed by the variable + light and heavy domains [44,57], and it + is, therefore, unlikely that this mutation would universally improve antibody stability and + affinity. Other than this mutation to Pro, we did not observe common sequence features among the + designs. Overlapping but non-identical sets of positions were varied in each of the three case + studies presented here, and the mutations at aligned positions were dissimilar. We, therefore, + concluded that the designs improved interactions across the vL-vH interface through a variety of + mechanisms that depended on the specific molecular structure of the parental antibodies.

    +

    Discussion

    +

    Our study demonstrates that improved + interactions across the vL-vH interface may result in substantial optimization of a range of + essential parameters for antibody development, including expressibility, stability, and + affinity. The automated AbLIFT strategy enables the design of cooperative networks of multipoint + mutations in the antibody core that are likely to be inaccessible to experimental affinity + maturation processes since these latter methods select mutations in a stepwise manner. Since + AbLIFT impacts the antibody core and does not alter the structure of the antigen-binding site, + the designed mutations cooperate with surface mutations identified through conventional + antibody-engineering processes to further increase affinity and stability. AbLIFT may be + particularly beneficial in antibodies, such as G6 and h492.1, which were the product of + antibody-engineering approaches that might compromise antibody structural integrity, resulting + in reduced affinity or stability. Moreover, antibody structure-prediction methods now often + produce atomically accurate models at the vL-vH interface (though still not at the CDR H3) + [58–60], + suggesting that by restricting design to the framework regions, AbLIFT may in some cases enable + antibody optimisation even in the absence of an experimental structure. We note, however, that + AbLIFT considers only phylogenetic information and molecular energetics and disregards + immunogenicity, which may be an important consideration in antibodies developed for clinical + use. To address this concern, the AbLIFT web server enables complete control over the design + sequence space and can be used to eliminate mutations with immunogenic potential.

    +

    The surprisingly broad ability of + vL-vH design to optimize antibody properties is consistent with the Colman interface-adaptor + hypothesis, according to which the formation of the Fv from two chains renders it flexible + [34]. According to this hypothesis, Fv flexibility is + likely to be an adaptive property selected by evolution to broaden molecular recognition by each + individual antibody to a range of antigens through induced fit or conformational selection + [61], thereby solving the conundrum of how a large but + finite antibody repertoire could recognize a potentially infinite range of antigens [62]. Flexibility, however, might come at a cost, + since an Fv that exhibits flexible vL-vH pairing may occupy multiple molecular states that + compete with the binding-competent state, thus lowering antigen-binding affinity. Flexibility + may moreover result in misfolding or transient dissociation of the two variable chains, + resulting in terminal aggregation or degradation by the cellular proteostasis machinery, thereby + lowering expression yields. In extreme cases, poorly defined packing at the vL-vH interface can + lead to substantial rearrangements of the antibody variable domain during binding [63], and such rearrangements could lower + antigen-binding affinity and specificity. Therefore, while the interface-adaptor hypothesis + neatly explains why flexibility at the vL-vH interface is advantageous in early steps of + antibody selection, broad specificity and marginal vL-vH interface stability become liabilities + in later stages of antibody development into research or therapeutic tools. We anticipate that + AbLIFT will have a wide scope to automatically and reliably improve stability, solubility, + expressibility, affinity, and structural integrity in numerous antibodies in which these + important properties are compromised.

    +

    Methods

    +

    D44.1 genetic library construction

    +

    Forward and reverse primers with the + degenerate codon NNS were generated for all 135 positions on the Fv of D44.1, essentially as + described [64]. Primers were ordered from Sigma (Sigma-Aldrich, + Rehovot, Israel) and were used to introduce all possible amino acids per position by QuickChange + mutagenesis [65]. Next, the PCR product of each position was + transformed into yeast (EBY100 cells) and plated on SD-Trp as described [66]. + Briefly, plates with more than 400 colonies were scraped with 1 ml SDCAA, 50 μl was added to 5 + ml SDCAA tube and cells were then grown at 30°C overnight. The point mutants were split into six + libraries, corresponding to positions that were at most 130 bp apart from one another to enable + deep mutational scanning using 150 bp reads.

    +

    Yeast surface display selection for libraries +

    +

    Yeast-display experiments were + conducted essentially as described [3]. Briefly, + yeast cells were grown in selective medium SDCAA overnight at 30°C. The cells were then + resuspended in 10 ml induction medium and incubated at 20°C for 20 h. 107 cells were then used for yeast-cell + surface display experiments: cells were subjected to primary antibody (mouse monoclonal IgG1 + anti-c-Myc (9E10) sc-40, Santa Cruz Biotechnology) for expression monitoring and biotinylated + ligand at 90 nM lysozyme (GeneTex) in PBS-F for 30 min at room temperature. The cells then + underwent a second staining with fluorescently labeled secondary antibody + (AlexaFluor488—goat-anti-mouse IgG1 (Life Technologies) for scFv labeling, Streptavidin-APC + (SouthernBiotech) for ligand labeling) for 10 min at 4°C. Next, the cell fluorescence was + measured and cells were collected under sorting conditions for expression and top 15% binders. + The selection gates were calibrated using the wild-type scFv D44.1 and these gates were + subsequently applied to the library constructs. Following fluorescence-activated cell sorting + (FACS), cells were grown in SDCAA for 1–2 days and plasmids were extracted using Zymoprep Yeast + Plasmid Miniprep II kit (Zymo Research).

    +

    Yeast surface display of anti-VEGF scFvs

    +

    18 designs of improved binding + affinity antibodies against VEGF and the wild-type G6 Fvs were ordered from Twist Biosciences as + scFvs. These, as described above, were amplified by PCR and cloned into pCTCon2 using homologous + recombination in yeast [66]. The plasmids were extracted by Zymoprep kit II, + transformed into bacteria for sequence validation and verified clones were transformed to yeast + for display [3]. The wild-type and designed antibodies were tested + for binding by flow cytometry with 8 nM biotinylated VEGF (Recombinant Human VEGF 165, + Biotinylated Protein R&D systems).

    +

    DNA preparation for deep sequencing

    +

    To connect the DNA adaptors for deep + sequencing, the plasmids extracted from the libraries were amplified using Phusion High-Fidelity + DNA Polymerase (ThermoFisher) in a two-step PCR protocol.

    +

    PCR 1:

    +

    (barcode: + CTCTTTCCCTACACGACGCTCTTCCGATCT)

    +

    >forward (seg1):<barcode>AGGGTCGGCTAGCCATATG

    +

    >forward (seg2):<barcode>GGATCGAATGGGTTAAACAACGT

    +

    >forward (seg3):<barcode>ACACCTCCTCTAACACCGC

    +

    >forward (seg4):<barcode>CTGGTGGCGGTGGCTC

    +

    >forward (seg5):<barcode>GCCGTGCGTCTCAGTCTATT

    +

    >forward (seg6): <barcode>CCATCTCGTTTCTCCGGC

    +

    >reverse: CTGGAGTTCAGACGTGTGCTCTTCCGATCTGGATCGAATGGGTTAAACAACGT +

    +

    The PCR product for each population + (expressed and top 15% of binders for each of the six libraries) was cleaned using Agencourt + AMPure XP (Beckman Coulter, Inc.) and 1 μl from a 1:10 dilution was taken to the next PCR step + for index labeling using KAPA Hifi DNA-polymerase (Kapa Biosystems, London, England):

    +

    >forward: + AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC

    +

    >reverse: + CAAGCAGAAGACGGCATACGAGAT<index>GTGACTGGAGTTCAGACGTGTGC

    +

    Top 15%—index: CAATAGTC

    +

    Expressed—index: TTGAGCCT

    +

    All the primers were ordered as + PAGE-purified oligos. The concentration of the PCR product was measured using Qu-bit assay (Life + Technologies, Grand Island, New York).

    +

    + Deep-sequencing runs

    +

    DNA samples were run on an Illumina + MiSeq using 150-bp paired-end kits. The FASTQ sequence files were obtained for each run, and + customized scripts were used to generate the selection heat maps from the data as previously + described [64]. Briefly, the script starts by translating the + DNA sequence to amino acid sequence; eliminates sequences that harbor more than one amino acid + mutation relative to wild type and also sequences that failed the QC test; counts each variant + in each population; and eliminates variants with fewer than 100 counts in the reference + population (to reduce statistical uncertainty).

    +

    Sequencing + analysis

    +

    To derive the mutational landscapes + we compute the frequency Pi,j of each mutant + relative to wild-type in the selected and reference pools, where i is the position and j is the substitution, relative to wild-type: +

    +

    where count is the number of reads + for each mutant. The selection coefficients are then computed as the ratio:

    +

    where selected refers to the top 15% binding + population and reference refers to the reference population (Expression). The resulting Si,j values are then transformed to + −ln enrichment values:

    + +

    + Computational methods

    +

    All Rosetta design simulations used + git version fb77c732b4f08b6c30572a2ef7760ad3bb4535ca of the Rosetta biomolecular modeling + software, which is freely available to academics at http://www.rosettacommons.org. + Position-Specific Scoring Matrices (PSSM) for designed antibodies against VEGF (PDB: 2FJG) and + against QSOX1 (PDB: 4IJ3) were collected as described in ref. [38] and are + distributed with the Rosetta release. RosettaScripts [67] and + command lines are available in Supplemental Data. As in the AbDesign method [38], + separate PSSMs were generated for CDRs 3 and for CDRs 1, 2 and the framework by aligning + structurally similar antibodies in the PDB and selecting only sequences that did not exhibit + gaps relative to the query sequence; furthermore, a strict cutoff of ≤ 0.5 Å backbone-carbonyl + rmsd was used to eliminate structurally divergent sequences. Thus, the PSSMs were only based on + structural considerations and not on sequence homology or source organism.

    +

    We refined each bound PDB structure + by four iterations of side-chain packing and side-chain and backbone minimization, saving the + minimum-energy structure. Computational mutation scanning was applied to the refined structure + using the FilterScan filter in Rosetta [24]. At + every position, each allowed mutation (that is, every amino acid identity with PSSM score ≥-1) + was modeled singly against the background of the refined structure. Protein side chains within 8 + Å of the modeled mutation were repacked, and side-chain and constrained backbone minimization + were used to accommodate the mutation. The energy difference between the refined structure and + the optimized configuration of the single-point mutant was calculated using the talaris2014 + energy function [68]. The energy threshold used to define the + tolerated mutation space was +1 R.e.u. We next enumerated all possible combinations of mutations + against VEGF (203,835 models) and against QSOX1 (491,235 models), modeled them in Rosetta and + relaxed them by sidechain packing and sidechain, backbone and rigid-body minimization with + harmonic backbone coordinate restraints. Designs were ranked based on their energy and the top + 18 designs differing by 4–10 mutations relative to one another (VEGF) (S2 Table) and the top 20 designs + differing by 3–14 mutations relative to one another (QSOX1) (S3 Table) were selected for + experimental characterization.

    +

    The AbLIFT + web-server

    +

    The web-server implements several + improvements relative to the method used to design the G6 and h492.1 variants [41]. In the AbLIFT web-server, the multiple-sequence + alignment used to construct the PSSM is first filtered to eliminate all loops and + secondary-structure elements that exhibit any gaps relative to the query sequence. Furthermore, + the web-server implements more accurate atomistic scoring and enables greater user control: it + uses the recent Rosetta energy function ref15 [69] with + improved electrostatics and solvation potentials relative to the previous Rosetta energy + function talaris and allows the user to manually modify the tolerated sequence space (for + instance, based on prior experimental data or to eliminate potential immunogenic sequence + signatures). Accordingly, ΔΔG + and PSSM cutoffs may be different from those used to in the designs described in the paper, and + the web server provides user control over these parameters.

    +

    Bacterial expression and + purification (D44.1 and D44.1des)

    +

    The design and wild-type were + transformed into RH2.2 plasmid for expression as Fabs, where the heavy chain was N-terminally + His-tagged and the light chain was expressed as a separate protein. Both chains contain a + secretion sequence for direction to the periplasmic space, where they fold and dimerize. + Restriction-free cloning was done using Kapa HiFi Hotstart Readymix (Kapa Biosystems) according + to the manufacturer’s protocol.

    +

    Cells were induced with 1 mM IPTG at + OD600 = 0.6, transferred to 20°C, and harvested after 20 h. The cells were then resuspended in + buffer A [20 mM phosphate buffer pH 6.2, 150 mM NaCl] and sonicated. The supernatant was + harvested by centrifugation (20,000 × g, 1 h), filtered, and loaded on HiTrap TALON + crude 1 ml column (GE Healthcare). Then it was washed with 15–20 bed volumes of buffer A, and + then eluted with buffer B [20 mM phosphate buffer pH 6.2,150 mM NaCl, 150 mM imidazole]. + Imidazole was removed from the eluate by dialysis against Buffer C [20 mM Hepes buffer pH 7,150 + mM NaCl] (1:400). The sample was then concentrated (Amicon Ultra-15 Centrifugal Filter; Merck) + and purified by gel filtration in buffer C over a HiLoad 16/600 Superdex 200 pg column.

    +

    Secreted IgG (G6, G6des13) and Fab (D44.1des) production in + suspension

    +

    Antibodies were expressed in + suspension-HEK293F cells, grown in FreeStyle medium (Gibco), in a shaking incubator (115 rpm), + at 37°C, in a controlled environment of 8% CO2. The variable regions of the different + heavy and light chains were cloned separately, upstream of IgG1 human Ab scaffolds, into p3BNC + plasmids. Transfections were done using linear 40 kDa polyethyleneimine (PEI) (Polysciences) at + 3 mg of PEI per 1 mg of plasmid DNA per 1 L of culture, at a cell density of 1 million cells/ml. + Growth media were collected after 5–7 days and separated from cells by centrifugation at 600 x + g. Media were then supplemented with 0.02% (wt/vol) sodium azide and 0.1 mM PMSF and further + clarified by centrifugation at 16,840 x g for 30 min.

    +

    Fab production (D44.1, G6, G6des1, G6des13)

    +

    Adherent HEK293T cells were + cotransfected with genes encoding the light and heavy chain Fabs (heavy chain fused to + C-terminal His tag) in p3BNC plasmids using linear PEI as a transfection reagent (12.5 μg/12.5 + μg/50 μg, respectively, per 15-cm plate). Seventy-two hours post-transfection, the medium + containing the secreted protein was collected (~250 ml).

    +

    Fab purification (D44.1, D44.1des, G6, G6des1, G6des13)

    +

    The filtered medium was concentrated + to ~200 ml using a diafiltration device (QuixStand Benchtop System; GE Healthcare). The medium + composition was exchanged to buffer A [50 mM Tris pH 8 and 150 mM NaCl] using the same device. + This was loaded on a HisTrap HP 5 ml column (GE Healthcare). Washed with 15 bed volumes of 20 mM + Tris pH 8, 150 mM NaCl and 10mM imidazole and was eluted with 20 mM Tris pH 8, 150 mM NaCl and + 250 mM imidazole. Imidazole was removed from the eluate by dialysis against Buffer A (1:400). + The sample was then concentrated (Amicon Ultra-15 Centrifugal Filter; Merck) and purified by gel + filtration in buffer A over a HiLoad 16/600 Superdex 200 pg column.

    +

    Apparent Tm and aggregation onset measurements +

    +

    The apparent melting temperature of + the antibodies was determined by Prometheus NT. Plex instrument (NanoTemper Technologies), a + label-free method. Fabs obtained from secreted Fab production in adherent cells (D44.1, G6, + G6des1, G6des13) and from production + in suspension (D44.1des) + were diluted to 0.2 mg/ml (in 20 mM Hepes pH 7 and 50mM NaCl for anti-lysozyme antibodies and in + 20 mM Hepes pH 7.5, 150 mM NaCl for anti VEGF antibodies). The temperature was ramped from 25°C + to 100°C at 0.05°C/s, and both Tm and aggregation-onset temperature + were measured.

    +

    + Surface-plasmon resonance

    +

    Surface plasmon resonance experiments + on the anti-lysozyme (D44.1 and D44.1des expressed in bacteria) and anti-VEGF + antibodies (G6, G6des1 + and G6des13 expressed in + adherent cells) were carried out on a Biacore T200 instrument (GE Healthcare) at 25°C with HBS-N + EP+ [10 mM Hepes, 150 mM NaCl, 3 mM EDTA, 0.005% vol/vol surfactant P20 (pH 7.4)]. For binding + analysis, 1,000–1,600 response units (RU) of Fab were captured on a CM5 sensor chip. Samples of + different protein concentrations were injected over the surface at a flow rate of 30 μL/min for + 240 s, and the chip was washed with buffer for 2,000 s. If necessary, surface regeneration was + performed with 30 s injection of 50 mM NaOH (D44.1des) or 10 mM NaOH (VEGF antibodies) at a + flow rate of 30 μL/min. One flow cell contained no ligand and was used as a reference. The + acquired data were analyzed using the device’s software, and kinetic fits were performed.

    +

    IgG Western blot analysis (G6, G6des1, G6des13)

    +

    HEK293T cells were seeded on a + 24-well plate pre-coated with poly-L-lysine at 120,000 cells/well. The next day, cells were + transfected with 1 μg DNA mixture consisting of 200 ng pLXN plasmid encoding Luciferase, 400 ng + of a plasmid encoding the light chains and 400 ng of a plasmid encoding the heavy chains of the + designated antibodies. Each transfection was carried in 100 μl DMEM in which 2 μg of linear + 40,000 Da PEI (Polysciences) per μg of DNA were mixed. The transfection mixture was added to + cells, for a total volume of 400 μl DMEM per well. 4 hours after transfection, cells were washed + and fresh 1 ml DMEM with 1% penicillin and streptomycin, glutamine and non-essential amino acids + was applied. 72 hours post-transfection supernatant was separated from cells and the cells were + resuspended in 500 μl PBS. A sample of 100 μl from the suspended cells from each well was + transferred to 96-well white plates (Nunc) with 100 μl of Bright-Glo reagent (Promega) to + quantify the level of luciferase as a proxy for the transfection efficiency. Adjusted volumes of + supernatants based on the luciferase levels were loaded on a gradient gel (Bio-Rad) and run + according to manufacturer's instructions. Semi-dry blotting was performed to a + nitrocellulose membrane followed by blocking in 5% milk powder in TBST (0.1% Tween 20, 20 mM + Tris pH 8.0, 150 mM sodium chloride) buffer for 30 min at room temperature. Donkey anti-human + IgG conjugated to HRP (Abcam) was used to detect the human IgG scaffold for 1 h at room + temperature.

    +

    Mass spectrometry sample preparation

    +

    Following IgG production in + suspension (as described above), clarified media were aliquoted, snap frozen in liquid nitrogen + and stored at -80°C. On the day of the measurements, samples were thawed and buffer exchanged + into 1 M ammonium acetate, pH 7, using Micro Bio-Spin 6 Columns (Bio-Rad). To break all + disulfide bonds, antibodies were then reduced for 4 h at 37°C in the presence of 20 mM TCEP, + followed by two consecutive buffer exchanges into 1 M and 150 mM ammonium acetate, respectively. +

    +

    + Native-mass spectrometry

    +

    Nanoelectrospray ionization + (nano-ESI) MS experiments were performed on a modified Q-Exactive Plus Orbitrap EMR (Thermo + Fisher Scientific, Bremen, Germany) [70]. All + spectra are shown without smoothing. The instrument was calibrated externally, using cesium + iodide. Typically, an aliquot of 2 μl protein solution was loaded into a gold-coated nano-ESI + capillary prepared in-house, as previously described [71], and + sprayed into the instrument. Conditions within the mass spectrometer were adjusted to preserve + noncovalent interactions. The source was operated in positive mode, the capillary voltage was + set to 1.7 kV, the capillary temperature was 180°C and argon was used as the collision gas in + the higher-energy collision-induced dissociation (HCD) cell. MS spectra were recorded at a + resolution of 10,000 and HCD voltage was set to 50 V, at trapping gas pressure setting of 3.9, + which corresponds to HV pressure of 1.04 x 10−4 mbar and UHV pressure of 2.35 x 10−10 mbar. Bent flatapole DC + bias and axial gradient were set to 2 V and 25 V, respectively.

    +

    + Gas-phase stability assay

    +

    Antibody stability was monitored by + tandem MS (MS/MS), at different HCD voltages. The 23+ charge state of the G6 and G6des13 antibodies was + isolated in the quadrupole, with an isolation window of 20 m/z, and the transmitted ions were + subjected to collision-induced dissociation in the HCD cell, at a gradient of accelerating + voltages ranging between 50–200 V. The relative abundance of the full IgG’s and the dissociated + light chains, recorded at the different HCD voltages, was determined by measuring their peak + heights. The total intensity of the light chains was calculated as the sum of intensities of + their corresponding charge states. In each experimental condition, the total intensities of all + the measured species were summed and referenced as 100% intensity. The relative intensity of + each species was then calculated as a percentage of the total intensity. The stability assay was + performed six times. Error bars represent standard deviation.

    +

    + Anti-QSOX1 antibody production

    +

    The coding sequences for variable + domains of antibody 492.1 were fused to human antibody constant regions [72]. + Mutations were introduced by site-directed mutagenesis into the resulting hybrid antibody + expression plasmids according to published procedures [73]. + Plasmids were transfected into suspension-adapted suspension-HEK 293F cells. The day before + transfection, cells were split to 0.7 x 106 cells/ml. For parallel expression of + the parent hybrid antibody and the 20 variants, transfections were performed using 0.5 μg of + each plasmid (heavy and light Ab chains) mixed with 3 μg PEI Max reagent (Polysciences Inc.) and + incubated 20 min in 24-well tissue culture trays prior to addition of 1 ml cells per well. + Plates were then agitated vigorously in a tissue culture incubator/shaker to prevent cell + settling. After 4 days, cultures were transferred to microfuge tubes, and cells were pelleted by + centrifugation at 500 x g for 10 min. Supernatants were transferred to fresh microfuge tubes, + from which aliquots were taken for quantification of antibody expression and activity. For + purification of selected Ab designs, transfections were done in 40 ml volumes, and plasmid and + PEI Max amounts were scaled up accordingly. Cultures were grown for 6 days, and Ab was purified + from the supernatant by protein G affinity chromatography (GE Healthcare).

    +

    QSOX1 dot blot and Western blot assays

    +

    Relative antibody concentrations were + determined from culture supernatants by dot and Western blotting. Blotting was conducted in + triplicate for each of two biological replicates. For dot blots, 2 μl of each supernatant was + spotted onto nitrocellulose membranes. Membranes were then covered with a blocking solution of + PBS containing 0.1% Tween (PBS-T) and 5% bovine serum albumin (BSA) and gently agitated for 1 h + at room temperature. For western blots, 10 μl of each supernatant was applied with non-reducing + gel loading buffer to 10% SDS polyacrylamide gels. After electrophoresis, proteins were + transferred to nitrocellulose, and the membranes were incubated in PBS-T with 5% BSA under + gentle agitation. For both dot and Western blots, horseradish peroxidase-conjugated antibody + recognizing human Fc was added to the blocking solution after the first hour, and + incubation/shaking was continued for another 45 min. The membrane was then washed three times + for 5 min each with PBS-T, and the blot was developed using SuperSignal West Pico (ThermoFisher) + chemiluminescent substrate. Dot and band intensities were recorded on a ChemiDoc XRS+ system + (Bio-Rad).

    +

    QSOX1 + inhibition assays

    +

    QSOX1 inhibition assays were + conducted by using 5,5-dithio-bis-2-nitrobenzoic acid (DTNB) to quantify the remaining + dithiothreitol (DTT) after incubation with purified recombinant QSOX1 and HEK293 culture + supernatants or purified antibody. Culture supernatants (25 μl) were mixed in a clear, + flat-bottom, 96-well plate with 12.5 μl of 40 nM QSOX1, and reactions were initiated by + injection of 12.5 μl 600 μM DTT (final concentrations 10 nM QSOX1 and 150 μM DTT). Reactions + were stopped after 30 min by adding 150 μl 500 μM DTNB, and absorbance at 412 nm was measured + after 5 min in a Tecan microplate reader.

    +

    Purified antibody variants were + quantified by absorbance at 280 nm after dilution into 6 M guanidine dissolved in PBS, using an + extinction coefficient of 187,000 M-1cm-1. Purified antibodies (12.5 μl) at + concentrations of 40 nM, 100 nM, and 200 nM were mixed in a 96-well plate with 12.5 μl 100 nM + QSOX1, and reactions were initiated by injection of 25 μl 600 μM DTT (final concentrations 25 nM + QSOX1, 300 μM DTT, and 10, 25, or 50 nM antibody). Reactions were stopped after 20 min by adding + 150 μl 500 μM DTNB, and absorbance at 412 nm was measured after 5 min. Background-subtracted + absorbance readings were normalized relative to the uninhibited and fully inhibited reactions + (the latter mimicked by leaving QSOX1 out of the reaction), and results were plotted in Fig 5C as + the relative inhibitory activity.

    +

    Supporting + information

    S1 Fig

    +

    a. Mutational tolerance mapping of the anti-lysozyme + antibody D44.1. Mutations that were enriched, depleted, or had insufficient data in + deep sequencing are marked in blue, red, and gray respectively. Wild type amino acids are + indicated in one-letter codes for each position. Disulfide-bonded cysteines are marked in black + triangles, and light-heavy chain interface positions in which point mutations exhibited over + threefold enrichment relative to wild type, are marked in pink triangles. b. Qualitative binding titrations using + yeast display for D44.1, D44.1des, and seven point mutants that + comprise D44.1des using yeast surface display. Binding fluorescence intensities are relative to + the highest concentration of 1 μM lysozyme.

    +

    (TIF)

    S2 Fig

    +

    a. The crystal structure of D44.1des (yellow and green for + heavy and light chains, respectively) shows high accuracy relative to the computational design + (lavender). Electron density at 2 σ. b. Crystallographic analysis of D44.1des shows high agreement + with D44.1 (0.7 Å Cα root-mean-square deviation), including in the orientations of + binding-surface residues (sticks; D44.1 in gray).

    +

    (TIF)

    S3 Fig

    Computational + mutation tolerance mapping enriches for low-energy designs.

    +

    (blue) the distribution of Rosetta + energies relative to G6 of a selection of >150,000 unique multipoint mutants at 11 positions + encoded in the tolerated sequence space computed by PSSM (≥-1) and ΔΔG (≤+1 R.e.u.) filters. (green) a random set + of multipoint mutants at 30 vL-vH interface (all interface positions were allowed), where any of + the 19 amino acid mutations was allowed at each mutated position. In both sets, the same number + of multipoint mutants was analyzed, and the same distribution of the number of mutations + relative to G6 was implemented. 37% of the multipoint mutants had energies that were more + favorable than G6, whereas less than 0.03% of the random mutants had more favorable energies + than G6. Thus computational mutation tolerance mapping enriches for improved mutants by over + 1,100-fold relative to random multipoint mutations.

    +

    (TIF)

    S4 Fig

    G6, G6des1, and G6des13 Fab expression and purification. +

    +

    (a) Following Ni-NTA purification, G6 + exhibits the expected band at 50 kDa, and additional bands at approximately 100 kDa, indicative + of sample heterogeneity. G6des13 and G6des1, by contrast, primarily elute at the + 50 kDa size range with no detectable higher-mass bands. (b) Designs G6des13 and G6des1 after gel filtration run at their + expected sizes. The status of reducing conditions (without DTT and boiling) is indicated at the + bottom of the gels.

    +

    (TIF)

    S5 Fig

    + Secreted full-length IgG1 G6 and G6des13 antibodies were reduced and + analyzed by native mass-spec directly from the growth medium.

    +

    Upper panels show the full spectra. + Charge state series of the two antibodies are labeled by dark blue and light blue circles, + respectively. The +23 charge state of each antibody was isolated in the quadrupole and subjected + to a gradual elevation of collision voltage in a stepwise manner, ranging from 50 to 200 V. + Light chains, which gradually dissociated from the intact antibodies, are labeled the by red and + orange circles.

    +

    (TIF)

    S6 Fig

    + All 20 h492.1 designs were expressed, and their activities from culture supernatants were + measured as described in the methods.

    +

    The highest values in the blot + reflect the greatest amounts of substrate remaining at the end of a QSOX1 sulfhydryl oxidase + activity assay, indicating the greatest inhibition of QSOX1 by the antibody. Due to differences + in expression levels (Fig 5A and 5B), inhibitory activity in this + experiment reflects a combination of expression yield and intrinsic activity. The designs with + results plotted in color (yellow and pink) were expressed in larger volumes, purified, and + compared quantitatively for inhibitory activity compared to the parental 492.1 antibody purified + from a hybridoma (Fig 5C).

    +

    (TIF)

    S1 Table

    Data collection and + refinement statistics for D44.1des, PDB code 6GC2.

    +

    (XLSX)

    S2 Table

    + The mutated positions and identities in G6 designs, colored according to their physicochemical + properties and sorted by normalized fluorescence value (measured by yeast display experiments). +

    +

    (DOCX)

    S3 Table

    + The mutated positions and identities in anti-QSOX1 492.1 designs, colored according to their + physicochemical properties.

    +

    (DOCX)

    S4 Table

    + Log-enrichment of the deep mutational scanning data of anti-lysozyme antibody D44.

    +

    Data retrieved from the deep + mutational scanning analysis of enrichment over WT for single point substitutions.

    +

    (XLSX)

    S1 Protocol

    RosettaScript for + refinement of structures retrieved from the PDB.

    +

    (TXT)

    S2 Protocol

    RosettaScript for single-point + mutational scanning.

    +

    (TXT)

    S3 Protocol

    + RosettaScript for combinatorial sequence design.

    +

    An example of a protocol for + designing a specific combinatorial mutant.

    +

    (TXT)

    S1 Text

    DNA sequences + of tested constructs.

    +

    (DOCX)

    S2 Text

    + Amino acid sequences of G6 and G6des13 IgGs.

    +

    Protein sequences used in the mass + spectrometry analyses.

    +

    (DOCX)

    +
    +

    References

    +
      +
    1. +
      + +
      + +
      +
      Affinity Maturation Increases the Stability and Plasticity + of the Fv Domain of Anti-protein Antibodies + +
        + + + + + +
      + +
      2. +
    2. +
      + +
      + +
      +
      + + Developability assessment in pharmaceutical industry: An integrated group approach for + selecting developable candidates + +
        + + + + +
      + +
      3. +
    3. +
      + +
      + +
      +
      Isolating and engineering human antibodies using yeast + surface display + +
        + + + + + + +
      + +
      4. +
    4. +
      + +
      + +
      +
      Directed evolution of antibody fragments with monovalent + femtomolar antigen-binding affinity + +
        + + + +
      + +
      5. +
    5. +
      + +
      + +
      +
      Substantial energetic improvement with minimal structural + perturbation in a high affinity mutant antibody + +
        + + + + + + +
      + +
      6. +
    6. +
      + +
      + +
      +
      + + Efficient affinity maturation of antibody variable domains requires co-selection of + compensatory mutations to maintain thermodynamic stability + +
        + + + + + +
      + +
      7. +
    7. +
      + +
      + +
      +
      High affinity, developability and functional size: The holy + grail of combinatorial antibody library generation + +
        + + + + +
      + +
      8. +
    8. +
      + +
      + +
      +
      Protein aggregation and bioprocessing + +
        + + + +
      + +
      9. +
    9. +
      + +
      + +
      +
      Effects of protein aggregates: an immunologic + perspective + +
        + +
      + +
      10. +
    10. +
      + +
      + +
      +
      + + Developability studies before initiation of process development: improving + manufacturability of monoclonal antibodies + +
        + + + + + + +
      + +
      11. +
    11. +
      + +
      + +
      +
      Strategies and challenges for the next generation of + therapeutic antibodies + +
        + + + + +
      + +
      12. +
    12. +
      + +
      + +
      +
      Computational design of antibody-affinity improvement beyond + in vivo maturation + +
        + + + +
      + +
      13. +
    13. +
      + +
      + +
      +
      Design of therapeutic proteins with enhanced + stability + +
        + + + + + +
      + +
      14. +
    14. +
      + +
      + +
      +
      Biophysical properties of the clinical-stage antibody + landscape + +
        + + + + + + +
      + +
      15. +
    15. +
      + +
      + +
      +
      Boosting antibody developability through rational sequence + optimization + +
        + + + + + + +
      + +
      16. +
    16. +
      + +
      + +
      +
      General strategy for the generation of human antibody + variable domains with increased aggregation resistance + +
        + + + + + + +
      + +
      17. +
    17. +
      + +
      + +
      +
      Structure-based design of supercharged, highly + thermoresistant antibodies + +
        + + + + + + +
      + +
      18. +
    18. +
      + +
      + +
      +
      Aggregation-resistant domain antibodies selected on phage by + heat denaturation + +
        + + + + +
      + +
      19. +
    19. +
      + +
      + +
      +
      Structural mechanism for affinity maturation of an + anti-lysozyme antibody + +
        + + + +
      + +
      20. +
    20. +
      + +
      + +
      +
      Automated Structure-and Sequence-Based Design of Proteins + for High Bacterial Expression and Stability + +
        + + + + + + +
      + +
      21. +
    21. +
      + +
      + +
      +
      Principles of Protein Stability and Their Application in + Computational Design + +
        + + +
      + +
      22. +
    22. +
      + +
      + +
      +
      One-step design of a stable variant of the malaria invasion + protein RH5 for use as a vaccine immunogen + +
        + + + + + + +
      + +
      23. +
    23. +
      + +
      + +
      +
      Automated selection of stabilizing mutations in designed and + natural proteins + +
        + + +
      + +
      24. +
    24. +
      + +
      + +
      +
      Optimization of affinity, specificity and function of + designed influenza inhibitors using deep sequencing + +
        + + + + + + +
      + +
      25. +
    25. +
      + +
      + +
      +
      Deep mutational scanning: a new style of protein + science + +
        + + +
      + +
      26. +
    26. +
      + +
      + +
      +
      High-resolution mapping of protein sequence-function + relationships + +
        + + + + + + +
      + +
      27. +
    27. +
      + +
      + +
      +
      + + Mutational landscape of antibody variable domains reveals a switch modulating the + interdomain conformational dynamics and antigen binding + +
        + + + + + + +
      + +
      28. +
    28. +
      + +
      + +
      +
      + + Deep mutational scanning of an antibody against epidermal growth factor receptor using + mammalian cell display and massively parallel pyrosequencing + +
        + + + + + + +
      + +
      29. +
    29. +
      + +
      + +
      +
      Robust in vitro affinity maturation strategy based on + interface-focused high-throughput mutational scanning + +
        + + + + + + +
      + +
      30. +
    30. +
      + +
      + +
      +
      Measuring the sequence-affinity landscape of antibodies with + massively parallel titration curves + +
        + + + + +
      + +
      31. +
    31. +
      + +
      + +
      +
      Saturation scanning of ubiquitin variants reveals a common + hot spot for binding to USP2 and USP21 + +
        + + + + +
      + +
      32. +
    32. +
      + +
      + +
      +
      Computational design of novel protein binders and + experimental affinity maturation + +
        + + + +
      + +
      33. +
    33. +
      + +
      + +
      +
      + + Three-dimensional structures of the free and the antigen-complexed Fab from monoclonal + anti-lysozyme antibody D44.1 + +
        + + + + + + +
      + +
      34. +
    34. +
      + +
      + +
      +
      Structure of antibody-antigen complexes: implications for + immune recognition + +
        + +
      + +
      35. +
    35. +
      + +
      + +
      +
      Antibody evolution constrains conformational heterogeneity + by tailoring protein dynamics + +
        + + + + + + +
      + +
      36. +
    36. +
      + +
      + +
      +
      Trends in antibody sequence changes during the somatic + hypermutation process + +
        + + + + +
      + +
      37. +
    37. +
      + +
      + +
      +
      Humanised antibodies + +
        + + + +
      + +
      38. +
    38. +
      + +
      + +
      +
      AbDesign: An algorithm for combinatorial backbone design + guided by natural conformations and sequences + +
        + + + + + + +
      + +
      39. +
    39. +
      + +
      + +
      +
      Principles for computational design of binding + antibodies + +
        + + + + + + +
      + +
      40. +
    40. +
      + +
      + +
      +
      Highly active enzymes by automated combinatorial backbone + assembly and sequence design + +
        + + + + + + +
      + +
      41. +
    41. +
      + +
      + +
      +
      Automated Design of Efficient and Functionally Diverse + Enzyme Repertoires + +
        + + + + + + +
      + +
      42. +
    42. +
      + +
      + +
      +
      Ultrahigh specificity in a network of computationally + designed protein-interaction pairs + +
        + + + + + + +
      + +
      43. +
    43. +
      + +
      + +
      +
      Why reinvent the wheel? Building new proteins based on + ready-made parts + +
        + + +
      + +
      44. +
    44. +
      + +
      + +
      +
      Analysis and prediction of VH/VL packing in + antibodies + +
        + + +
      + +
      45. +
    45. +
      + +
      + +
      +
      + + Structure-Function Studies of Two Synthetic Anti-vascular Endothelial Growth Factor Fabs + and Comparison with the Avastin Fab + +
        + + + + + + +
      + +
      46. +
    46. +
      + +
      + +
      +
      Loss of Nkx3.1 leads to the activation of discrete + downstream target genes during prostate tumorigenesis + +
        + + + + + + +
      + +
      47. +
    47. +
      + +
      + +
      +
      An inhibitory antibody blocks the first step in the + dithiol/disulfide relay mechanism of the enzyme QSOX1 + +
        + + + + +
      + +
      48. +
    48. +
      + +
      + +
      +
      The dynamic disulphide relay of quiescin sulphydryl + oxidase + +
        + + + + + + +
      + +
      49. +
    49. +
      + +
      + +
      +
      High-affinity human antibodies from phage-displayed + synthetic Fab libraries with a single framework scaffold + +
        + + + + + + +
      + +
      50. +
    50. +
      + +
      + +
      +
      Role of conformational sampling in computing + mutation-induced changes in protein structure and stability + +
        + + + +
      + +
      51. +
    51. +
      + +
      + +
      +
      Eris: an automated estimator of protein stability + +
        + + + +
      + +
      52. +
    52. +
      + +
      + +
      +
      Developability assessment during the selection of novel + therapeutic antibodies + +
        + + + + + + +
      + +
      53. +
    53. +
      + +
      + +
      +
      De novo design of protein homo-oligomers with modular + hydrogen-bond network-mediated specificity + +
        + + + + + + +
      + +
      54. +
    54. +
      + +
      + +
      +
      Inspired by nature: designed proteins have structural + features resembling those of natural active sites + +
        + + +
      + +
      55. +
    55. +
      + +
      + +
      +
      + +
        + + + + + +
      -
    -
    - - - + +
  1. +
    + +
    + +
    +
    Disulfide bond generation in mammalian blood serum: + detection and purification of quiescin-sulfhydryl oxidase + +
      + + + + +
    + +
    2. +
  2. +
    + +
    + +
    +
    The association of heavy and light chain variable domains in + antibodies: implications for antigen specificity + +
      + + + +
    + +
    3. +
  3. +
    + +
    + +
    +
    Second antibody modeling assessment (AMA-II) + +
      + + + + + + +
    + +
    4. +
  4. +
    + +
    + +
    +
    + + High-accuracy modeling of antibody structures by a search for minimum-energy recombination + of backbone fragments + +
      + + + +
    + +
    5. +
  5. +
    + +
    + +
    +
    AbPredict 2: a server for accurate and unstrained structure + prediction of antibody variable domains + +
      + + + + +
    + +
    6. +
  6. +
    + +
    + +
    +
    Structural evidence for induced fit as a mechanism for + antibody-antigen recognition + +
      + + + +
    + +
    7. +
  7. +
    + +
    + +
    +
    A theory of the structure and process of formation of + antibodies + +
      + +
    + +
    8. +
  8. +
    + +
    + +
    +
    Major antigen-induced domain rearrangements in an + antibody + +
      + + + + + +
    + +
    9. +
  9. +
    + +
    + +
    +
    + + Mutational scanning reveals the determinants of protein insertion and association + energetics in the plasma membrane + +
      + + + + + + +
    + +
    10. +
  10. +
    + +
    + +
    +
    An efficient one-step site-directed deletion, insertion, + single and multiple-site plasmid mutagenesis protocol + +
      + + +
    + +
    11. +
  11. +
    + +
    + +
    +
    + + Frozen competent yeast cells that can be transformed with high efficiency using the + LiAc/SS carrier DNA/PEG method + +
      + + +
    + +
    12. +
  12. +
    + +
    + +
    +
    RosettaScripts: a scripting language interface to the + Rosetta macromolecular modeling suite + +
      + + + + + + +
    + +
    13. +
  13. +
    + +
    + +
    +
    Combined covalent-electrostatic model of hydrogen bonding + improves structure prediction with Rosetta + +
      + + + + + + +
    + +
    14. +
  14. +
    + +
    + +
    +
    Simultaneous Optimization of Biomolecular Energy Functions + on Features from Small Molecules and Macromolecules + +
      + + + + + + +
    + +
    15. +
  15. +
    + +
    + +
    +
    Triple-Stage Mass Spectrometry Unravels the Heterogeneity of + an Endogenous Protein Complex + +
      + + + + + + +
    + +
    16. +
  16. +
    + +
    + +
    +
    Analyzing large protein complexes by structural mass + spectrometry + +
      + + + +
    + +
    17. +
  17. +
    + +
    + +
    +
    + + Efficient generation of monoclonal antibodies from single human B cells by single cell + RT-PCR and expression vector cloning + +
      + + + + + + +
    + +
    18. +
  18. +
    + +
    + +
    +
    Applications of the Restriction Free (RF) cloning procedure + for molecular manipulations and protein expression + +
      + + + + + +
    + +
    19. +
+ +
\ No newline at end of file diff --git a/src/examples/article-drosophila.html b/src/examples/article-drosophila.html index 370d52a3c..9a2769565 100644 --- a/src/examples/article-drosophila.html +++ b/src/examples/article-drosophila.html @@ -1,1114 +1,439 @@ - - - - Neuropeptide F regulates courtship in Drosophila through a male-specific neuronal circuit - - - - - - - - - - - -
-
- -
- -
-
-

- - Neuropeptide F regulates courtship in Drosophila through a male-specific - neuronal circuit

- -
    - - - - - - - - +
    +
    + +
    + +
    +
    +

    + + Neuropeptide F regulates courtship in Drosophila through a male-specific neuronal + circuit

    + +
      +
    -

    10.7554/eLife.49574.026Figure - 4—source data 4.

    +

    10.7554/eLife.49574.007Figure + 1—figure supplement 1—source data 4.

    Figure 4B Summary statistics.

    + id="figure-1figure-supplement-1b-summary-statistics">Figure 1—figure supplement + 1B Summary statistics.
    @@ -1168,11 +496,86 @@

-

10.7554/eLife.49574.027Figure - 4—source data 5.

-

Figure 4F Source - data.

+ + + +
  • +
    +
    +

    + Genotyping, testing for NPF expression, and courtship assays using the npf1 and npfLexA mutants.

    +

    (A) Schematic showing the npfLexA knock-in + reporter/mutant line generated using CRISPR-HDR. Shown below is the genotyping employing + the indicated primer pairs, which confirms the integration of LexA and the mini-white coding sequences and + disruption of the endogenous npf gene. The stars indicate + non-specific bands generated in the control (w1118-CS) and npfLexA during the PCR + amplification. (B—E) npfLexA, npf1, P[g-npf+];npfLexA and control male + brains stained with anti-NPF. The scale bars represent 50 μm. (F) Group-housed npf1 and npfLexA males were assayed + for courtship towards mature active female targets. n = 24. (G) Isolation-housed npf1 and npfLexA mutants were assayed + for male-male (M–M) courtship. n = 15—19. The bars indicate means ± SEMs. The + Kruskal-Wallis test followed by Dunn’s post hoc test was used to assess + significance. *p < 0.05.

    +

    10.7554/eLife.49574.009Figure + 1—figure supplement 2—source data 1.

    +

    Figure 1—figure supplement 2F Source data. +

    +
    +
    + +
    + +
    +
    +
      +
      +

      10.7554/eLife.49574.010Figure + 1—figure supplement 2—source data 2.

      +

      Figure 1—figure supplement 2F Source data. +

      @@ -1184,11 +587,29 @@

      -

      10.7554/eLife.49574.028Figure - 4—source data 6.

      +

      10.7554/eLife.49574.011Figure + 1—figure supplement 2—source data 3.

      Figure 4F Summary statistics.

      + id="figure-1figure-supplement-2g-source-data">Figure 1—figure supplement 2G Source data. + +
      +
      + +
      + +
      +
      +
        +
        +

        10.7554/eLife.49574.012Figure + 1—figure supplement 2—source data 4.

        +

        Figure 1—figure supplement + 2G Summary statistics.

        @@ -1202,356 +623,441 @@

        To activate NPFM neurons, we employed a similar - FlpOut approach, using UAS - > stop > trpA1/npf-Gal4; fruFLP/ +flies, to express the - thermally-activated TRPA1-A isoform in NPFM neurons only. This TRPA1 isoform is - a Na+ and Ca2+-permeable channel, - which is activated at temperatures above ~ 27 °C (Viswanath et al., - 2003). To perform these assays, we used decapitated females since intact - females stimulate ceiling levels of male courtship, which are resistant to down-regulation, - while decapitated females induce moderate levels, which facilitate detecting subtle - decreases in male courtship. We found that courtship levels in UAS > stop > trpA1/npf-Gal4;fruFLP/+ males were - suppressed at 29°C relative to 23°C (Figure 4B). In contrast, none of the three - types of control flies exhibited lower male courtship at 29°C (Figure 4B). Nevertheless, because the CI - exhibited by the UAS > stop - > trpA1/npf-Gal4;fruFLP/+ males at 29°C was not - elevated relative to the CIs displayed by the control males at 29°C, the results preclude - the conclusion that activation of sexually dimorphic NPFM neurons inhibits male courtship. -

        -

        To test whether the NPF produced - in NPFM neurons is - responsible for inhibiting male courtship, we knocked down NPF expression in distinct groups - of neurons. To conduct these experiments, we used UAS-npf-RNAi, which was effective as it - greatly reduced NPF levels (Figure 4C—E). We found that knocking down npf expression with the fru-Gal4 induced a dramatic - increase in M–M courtship, and did so to a similar extent as when we used a pan-neuronal - (elav) Gal4 or the npf-Gal4 (Figure 4F).

        -

        To specifically interrogate a - requirement for NPF in NPFM neurons, we used FlpOut to - introduce Gal80 (which - binds and inhibits Gal4 - activity) in either fru+ or fru- neurons, thereby confining UAS-npf-RNAi expression to - fru- NPF neurons or NPFM neurons, respectively. To knockdown - npf specifically in - NPFM neurons, we used - the following flies that cause excision of Gal80 in fru neurons only, thereby allowing Gal4 expression and RNA - knockdown in NPFM - neurons: npf-Gal4/tub > Gal 80 - >stop;UAS-npf-RNAi/ +

      1. +
        +
        +

        Illustration of the aggression chamber.

        +

        (A) Top view of the aggression + chamber. (B) + Side view of the aggression chamber. The numbers indicate the dimensions in mm. (C) Side view of the + chamber with slide cover and addition of two males.

        +
        +
        +
        2. + +

        To clarify if it is the molecule NPF, + rather than just NPF neurons, which is responsible for regulating sex drive, we generated two + npf null mutants. To create + npfLexA, we replaced the npf gene with the LexA reporter using CRISPR-HDR + (Figure 1D and Figure 1—figure supplement + 2A,B and C) . We also used the CRISPR-NHEJ method to generate an allele with a single + nucleotide deletion, thereby changing the reading frame within codon 19, resulting in a null npf allele (npf1; Figure 1E and Figure 1—figure supplement 2B and E).

        +

        The courtship index of isolated + control males reaches a ceiling level when they were exposed to mature active female targets + (Huang et al., + 2016). Therefore, to test whether npf mutant males exhibit an increase in + courtship, we used mixed sex group-housed males, which in control flies showed a moderate level + of courtship activity due to sexual satiation in the presence of an abundance of females. We + found that mixed sex group-housed npf mutant males (npfLexA and npf1 and the trans-heterozygous npfLexA/npf1) retained high levels of + courtship towards mature active female targets (Figure 1F and Figure 1—figure supplement 2F), indicating the + mutants were resistant to sexual satiety induced by group-housing.

        +

        We found that the hypersexual + activity in npf mutant males + was generalized towards normally undesirable targets. These include females of other Drosophila species such as D. simulans females (Clowney et al., + 2015) (Figure 1G), and male target flies (Figure 1H and Figure 1—figure supplement 2G). The + increased courtship towards males was not due to an inability to discriminate between males and + females. When the mutant males were allowed to choose between a decapitated male and a + decapitated female, they showed a strong preference for female targets, similar to control males + (Figure 1I).

        +

        To determine if this increase in + courtship is an outcome of sensitized pheromone detection, we introduced newly-eclosed females, + which carry negligible cuticular hydrocarbons and are therefore odorless/tasteless targets to + tester males (Liu et + al., 2011). We found that compared to control males, npf mutant males (npfLexA/npf1) exhibited significantly higher + levels of courtship towards these females (Figure 1J). Thus, elevated courtship exhibited by + npf mutant males did not + appear to be caused by sensitized perception of attractive female pheromones. To test the + possibility that the higher courtship levels was due to higher visual alertness in the mutants, + we combined the males with motionless decapitated females as targets. Compared to control males, + npf mutants exhibited + increased courtship towards decapitated females (Figure 1K). To further establish that the + courtship phenotype was due to loss of npf, we performed phenotypic rescue + experiments with a wild-type npf genomic transgene (P[g-npf+], which restored npf expression to the npf mutant (Figure 1—figure supplement 2B—D). + This genomic transgene also rescued normal levels of male courtship behavior to the npf mutant males (Figure 1F—H,J and K). + Together, these experiments indicate that loss of npf function stimulates a sexually + hyperactive state in males.

        +

        Sexually dimorphic NPFM neurons suppress male + courtship

        +

        To examine the spatial distribution + of the NPF neurons, we expressed lexAop-IVS-mVenus under the control of the + LexA that we knocked into the + npf gene (npfLexA/+). Among the neurons that + were labeled by the npf + reporter, was a bilaterally symmetrical cluster of NPF neurons that was male specific (NPFM; Figure 2A and B). The cell bodies of + these sexually-dimorphic neurons are dorso-lateral to the antennal lobes and arborize + extensively in the superior brain (Figure 2A and B). NPFM neurons can be differentiated from + other NPF neurons based on their position in the anterior brain region that is immediately + adjacent to antennal lobe. Moreover, NPFM form a cluster of 3— 5 neurons and + their cell bodies are smaller than the pair of dorsal medial and the pair of dorsal lateral + large NPF neurons. We used anti-NPF antibodies to immunostain the brain and found that the + reporter expression pattern recapitulates the spatial distribution of the NPF protein (Figure 2C, c1-c6), + confirming that NPFM + neurons express NPF.

        +
          +
        1. +
          + +
          +

          Identification of male-specific + NPFM neurons. +

          +

          (A and B) npfLexA/LexAop-IVS-mVenus male and female + brains immunostained with anti-GFP to detect mVenus. The boxes indicate NPFM neurons, and the + circles indicate the antennal lobes. (C) npfLexA/LexAop-IVS-mVenus male brain + immunostained with anti-GFP and anti-NPF. NPFM neurons are boxed. (c1—c6) Zoomed in + images showing NPFM neurons. (D) npfLexA/LexAop-IVS-mVenus male brain + immunostained with anti-GFP and anti-FruM. The boxes indicate NPFM neurons. (d1—d6) Zoomed in images showing + NPFM neurons. + (E and F) fru mutant (fruFLP/fruFLP) and control fruFLP/+ male brains + immunostained with anti-NPF. The boxes indicate NPFM neurons. The scale bars in A—F + represent 50 μm. The scale bars in c1—c6 and d1—d6 represent 10 μm.

          +
          +
          +
          2. +
        2. +
          +
          +

          w1118-CS male flies stained + with anti-NPF and anti-DsxM.

          +

          (A) Anti-DsxM. (B) Anti-NPF. (C) Merge of A) and B). The boxes outline the region + containing NPFM + neurons, shown at higher magnification in a1—c1 and a2—c2. The scale bars represent 50 + μm in A—C and 10 μm in a1—c1 and a2—c2.

          +
          +
          +
          3. +
        +

        The fruitless (fru) gene is a master regulator of male + courtship behavior, and its role is mediated through expression of a male-specific protein, + FruM, which is produced through alternative mRNA splicing (Ito et al., 1996; Ryner et al., + 1996; Lee et al., 2000; Demir and Dickson, 2005; + Manoli et al., + 2005; Stockinger et al., 2005). We examined whether NPFM neurons expressed the FruM protein by + performing double labeling using anti-FruM, and anti-GFP, which marks the cells expressing mVenus driven by the npfLexA reporter. We found that + NPFM neurons expressed + FruM (Figure 2D, + d1—d6), while they were negative for DsxM (Figure 2—figure supplement 1), another key protein + regulating the organization of the male nervous system (Rideout et al., 2010; + Robinett et al., + 2010).

        +

        To determine if FruM is essential for + determining the fate of NPFM neurons, we used anti-NPF antibodies to + stain the brains of fruFLP mutant (Yu et al., + 2010) males. We found that staining of NPFM neurons was eliminated in fruFLP males (Figure 2E and F), indicating that + specification of NPFM + neurons depends on FruM.

        +

        To distinguish the projection pattern + of NPFM neurons from the + remaining NPF neurons, we used the FlpOut method (Wong et al., 2002) to + specifically label NPFM + neurons with mCitrine. In the absence of both fruFLP and npfLexA, neither mCherry nor mCitrine is expressed (Figure 3A). If the flies contain the + fruFLP transgene but not the npfLexA transgene, the mCherry gene is removed due to + expression of Flp (FlpOut), but mCitrine is not expressed (Figure 3B). In flies with npfLexA but no fruFLP, mCherry is expressed, but mCitrine is not expressed due to the + transcriptional stop cassette + downstream of the coding region for mCherry (Figure 3C). If flies harbor both the fruFLP and npfLexA transgenes, then mCherry is removed by FlpOut in + fru-expressing neurons, and + mCitrine is expressed (Figure 3D). Therefore, + NPFM are the only neurons + labeled with mCitrine. Using this intersectional method, we found that NPFM neurons extensively arborize a large + proportion of the superior brain of the male (Figure 3E—G and Video 1). In contrast, there were no + mCitrine-labeled neurons in the female brain (Figure 3H). Rather, the NPF neurons in females + were labeled with mCherry only + (Figure 3I and J).

        +
        +
        +

        Labeling of NPFM neurons using the FlpOut method. +

        +

        (A—D) Schematic illustration of the + FlpOut method to label NPFM neurons. Only neurons that express + both fru (fruFLP flies. Conversely, to - prevent npf knockdown in - NPFM neurons, we - expressed Gal80 - specifically in these neurons using npf-Gal4/tub > stop > Gal80;UAS-npf-RNAi/fruFLP flies. We found that - knocking down npf - exclusively in NPFM - neurons elevated M–M courtship while npf knock down in fru- NPF neurons did not change the - level of male courtship (Figure 4F). These results indicate that - sexually dimorphic NPFM neurons are the subset of NPF - neurons that are exclusively required for suppressing male courtship, and the effect is - dependent on NPF produced in NPFM neurons.

        + itemtype="http://schema.stenci.la/Superscript">FLP        ) and npf (npfLexA) will express mCitrine. (E—G) Expression patterns + of mCitrine (stained with + anti-GFP) and mCherry + (stained with anti-DsRed) in a male brain. The white dashes outline the SMPr arch and + lateral junction regions of the LPC. Arrowheads indicate NPFM soma. (H—J) mCitrine and mCherry expression patterns in a female + brain. The scale bars represent 50 μm.

        +
        +
        +
        +
        + +
        + +
        +
        +
          +
          +

          To address whether NPFM neurons are exclusively + responsible for regulating male courtship, we expressed a conditional repressor or activator + specifically in NPFM + neurons. To inhibit NPFM + neurons, we used the temperature sensitive Shits, which we expressed in NPFM neurons only using the + FlpOut method. We employed a transgene that encodes Shits downstream of a 5’ + transcriptional stop cassette + that is flanked by FRT sites ( UAS + > stop >  Shits ; note that ‘ >” indicates FRT sites), and removed the + stop cassette specifically in + fru neurons by expressing + flippase exclusively in fru + neurons with the fruFLP. After the stops are removed, we expressed + UAS-Shits under control of the npf-Gal4, thereby restricting + Shits to NPFM neurons only. When we + performed courtship assays at the non-permissive temperature for Shits (31 °C), the males showed elevated + courtship relative to flies with the same genotype that were assayed at the permissive + temperature (23°C) for Shits (Figure 4A). We then tested the effects of + inhibiting neurons except for NPFM neurons, using npf-Gal4/+;fruFLP/ UAS > Shits >  stop flies, which removes + Shits just in NPFM neurons. These males + displayed similar levels of courtship at both the permissive temperature and non-permissive + temperatures for Shits + (Figure 4A).

          +
          +

          P1 neurons directly activate NPFM neurons

          -

          To address how NPFM neurons are integrated - into the fru circuit, we - adopted the GRASP (GFP Reconstitution Across Synaptic Partners) (Feinberg et al., 2008; - Gordon and - Scott, 2009) method to detect potential contact loci between NPF neurons and - fru neurons. This approach - employs a dual binary expression system to synthesize two complementary but non-functional - parts of GFP (spGFP1-10 and spGFP11) on the cell membranes of distinct neurons. When the - neurons are in close proximity, GFP is reconstituted and fluorescence is produced. We - expressed spGFP1-10 and spGFP11 in fru and NPF neurons, respectively and - detected strong bouton-shaped GFP signals in the male brain (Figure 5A) but only sparse signals in the - female brain (Figure - 5B) and no specific reconstituted GFP signals in control male brains missing the - driver for the LexAop-spGFP11 (Figure 5C). The reconstituted GFP - signals in the male brain reconstruct a distinctive male-specific brain structure – the - lateral protocerebral complex (LPC), which includes several neuropils: the lateral junction, - superior medial protocerebrum (SMPr) arch, lateral crescent and the ring structure (Figure 5—figure - supplement 1A) (Yu et al., 2010). The LPC structure is formed by neural - projections from a cluster of male-specific P1 neurons which function as the integrative hub - controlling male courtship behavior (Kimura et al., 2008; - Yu et al., - 2010; Kohatsu et al., 2011; von Philipsborn et al., - 2011; Pan et al., 2012; Bath et al., 2014; - Inagaki et al., - 2014; Clowney et al., 2015; Kallman et al., 2015; - Zhou et al., - 2015; Zhang et al., 2016).

          -
            -
          1. -
            -
            -

            Anatomical - and functional interactions between P1 and NPFM neurons.

            -

            (A—C) GRASP approach to examine - close interactions between NPF and fru neurons in UAS-spGFP1-10, LexAop-spGFP11/NP21-Gal4, npfLexA flies. GFP - fluorescent signals indicate close associations. (A) Reconstituted GFP signals in - a male brain. The arrows indicate the SMPr arch and lateral junction structures. - (B) - Reconstituted GFP signals in a female brain. (C) Negative control for GRASP - showing a UAS-spGFP1-10, LexAop-spGFP11/NP21-Gal4 male brain. Scale bars - indicate 50 μm. A portion of the brain stacks, including the LPC structure, is - shown. The full brain stacks are presented in the source data files. (D—F) FlpOut - approach to differentially label P1 neurons and NPFM neurons. (D) Anti-GFP - stained fru-positive P1 (due to smGdP expression) - and NPFM - neurons. Arrows indicate the SMPr arch and the lateral junction. Arrowheads indicate - the soma of NPFM neurons. (E) Anti-V5 - exclusively labels NPFM neurons. The arrowheads - indicate soma of NPFM neurons. (F) Composite of P1 - and NPFM - neurons. The arrowheads indicate NPFM soma. The scale bar - represents 50 μm. (G—I) GRASP approach to examine - close interactions between NPF and P1 neurons in UAS-spGFP1-10,LexAop-spGFP11/R71G01-Gal4,npfLexA flies. GFP - fluorescent signals indicate close associations. (G) Reconstituted GFP signals in - a male brain. Arrows indicate lateral junction and SMPr arch of the LPC. The - arrowhead indicates an example of a reconstituted GFP signal. (H) Reconstituted GFP signals in - a female brain. (I) Negative control for GRASP - showing a UAS-spGFP1-10, LexAop-spGFP11/R71G01-Gal4 male brain. Scale - bars indicate 50 μm. A portion of the brain stacks, including the LPC structure, is - shown. The full brain stacks are presented in the source data files.

            -

            - 10.7554/eLife.49574.033Figure 5—source data 1.

            -

            Figure 5A—C, G—I Full stacks.

            -
            -
            - -
            - -
            -
            -
              -
              -
              -
              -
              1. -
            1. -
              -
              -

              - Cartoons of male brains showing the approximate positions of selected brain regions - and neurons.

              -

              (A) Schematic illustration of - the LPC structure formed by P1 neuronal processes. Lateral junction, SMPr arch, - lateral crescent and ring of the LPC are indicated. (B) Schematic illustration of - NPFM neurons. - (C) - Schematic illustration of composite of NPFM neurons and LPC structure. -

              -
              -
              -
              2. -
            2. -
              -
              -

              - Comparison of the projection patterns of NPF and P1 neurons in a male brain.

              -

              (A—C) UAS-mCD8::RFP,LexAop-mCD8::GFP/+,Y;;R71G01-GAL4/npfLexA male and female - brains immunostained with anti-GFP and anti-DsRed (stains RFP), which labels NPF and - P1 neurons, respectively. (A—C) RFP and GFP expression patterns in a male - brain. The boxed regions indicate the LPC. NPFM neurons are indicated by - the arrows. (D—F) RFP and GFP expression patterns in a - female brain. Scale bars indicate 50 μm.

              -
              -
              -
              3. -
            3. -
              -
              -

              Directionality of - connections between P1 and NPFM neurons.

              -

              (A) Pre- and post-synaptic - regions of P1 neurons were labeled with Syt::eGFP and DenMark, respectively in a - male brain from a UAS-DenMark,UAS-Syt::eGFP/+;R71G01-Gal4/+fly. - DenMark and Syt::EGFP were detected with anti-DsRed and anti-GFP, respectively. The - boxes indicate the lateral junction and SMPr arch of the LPC, which are contoured in - a1—a6. (B) - Pre- and post-synaptic regions of NPF neurons were labeled with Syt::eGFP and - DenMark, respectively in an npf-Gal4/UAS-DenMark,UAS-syt::eGFP male brain. The box - to the left shows the LPC region (contoured in b1 —b3). The box to the right shows - the medial anterior brain. Bouton-shaped syt::eGFP signals in this region are - contoured in b4—b6. (C) npf-Gal4/ UAS > stop > mCD8::GFP;fruFLP/+ male brain - stained with anti-NPF and anti-GFP. The left box outlines the LPC region, which is - contoured in (c1 —c3). The right box shows - boutons that are double-stained with both antibodies in the medial anterior brain, - and contoured in (c4 —c6). The scale bars represent - 50 μm in panels (A —C), and 20 μm in panels - (a1 —a6), (b1 —b6) and (c1 —c6).

              -
              -
              -
              4. -
            -

            To compare the projection - patterns of NPF and P1 neurons, we expressed GFP and RFP in NPF and P1 neurons, - respectively, using two binary expression systems. We found that the projections from NPF - neurons overlapped with the LPC structure in the male brain (Figure 5—figure supplement 2A—C). However, the - female brain does not include an LPC structure (Figure 5—figure supplement 2D—F). We further - combined the FlpOut method and dual binary expression systems to exclusively label NPFM and P1 neurons, and - found that the projections from these two clusters of neurons overlapped intensely in LPC - region (Figure 5D—F - and Figure 5—figure - supplement 1 and Video 2).

            + id="specificity-of-npfm-neurons-in-regulating-male-courtship">Specificity of NPFM neurons in regulating + male courtship.

            +

            (A) Single tester males of the indicated + genotypes were assayed for male-female (M–F) courtship at both permissive (23°C) and + non-permissive (31°C) temperatures for Shits. Newly-eclosed male flies were + isolated for 5 days, after which they were housed with 5—7 w1118 virgin female flies for 4 + hr prior to the experiment. 7—15 day-old mature active mated w1118 female flies were used as + targets. The courtship index is the mean ratio of time spent by the tester male in courtship + within 30 min following a 10 min incubation period. n = 8—24. Bars indicate means ± SEMs. + Significance was determined using Mann-Whitney test. **p < 0.01. (B) Single tester males of the indicated + genotypes were assayed for courtship at two different temperatures (23°C and 29°C). + Newly-eclosed males that were isolated for 2 days were used as testers. Decapitated w1118 female flies were used as + the targets. Courtship index represents the mean ratio of time the male flies spent in + courting within 10 min following a 5 min incubation period. n = 6—27. Bars indicate + means ± SEMs. Significance was determined using Mann-Whitney test. **p < 0.01. (C—E) Immunohistochemistry + showing the effect of npf + RNAi knock down on NPF protein expression in male brains. Control genotypes of npf-Gal4/+ and UAS-npf-RNAi male brains and + experimental genotype of npf-Gal4/+;UAS-npf-RNAi/+ male brains were + immuno-stained with anti-NPF. Scale bars indicate 50 μm. (F) Effects on male-male (M–M) courtship + due to RNAi knock down of + npf in all neurons (elav), fru neurons, npf neurons, non-NPFMnpf neurons and NPFM neurons. n = 7—12. The bars + indicate means ± SEMs. Mann-Whitney test was used to determine significance. **p < 0.01. +

            +

            10.7554/eLife.49574.023Figure + 4—source data 1.

            +

            Figure + 4A Source data.

            @@ -1563,275 +1069,11 @@

            -

            To address if the projections of - NPF and P1 neurons form direct connections, we used the R71G01-Gal4 (which is expressed in P1 - neurons and a few other neurons) to drive expression of spGFP1-10, and npfLexA to drive expression of - spGFP11. We detected strong GFP signals reconstructing the LPC structure in the male brain - (Figure 5G), but - not in the corresponding brain regions of female brains or control male brains that do not - have the driver for LexAop-spGFP11 (Figure 5H and I). The GRASP GFP - signals appear to be due to expression of the two parts of the split GFP in NPFM and P1 neurons for the - following reasons. First, NPFM and P1 neurons are both - male-specific, and the GRASP signals are primarily in the male brain and not in the female - brain (Figure 5G and - H). Second, the GRASP signals label two LPC structures: the lateral junction and SMPr - arch (Figure 5G). - Third, the projections of NPFM and P1 overlap extensively in the - lateral junction and SMPr arch (Figure 5D—F and Video 2), while fru- NPF projections do not - innervate the LPC region (Figure 3F and G and Video 1). Thus, the GRASP signals - in the LPC structure appear to be formed by connections between NPFM and P1 neurons.

            -

            To clarify the directionality of - the synaptic connections between NPFM and P1 neurons, we employed - genetically encoded markers to label the dendritic (UAS-DenMark) and axonal (UAS-syt::eGFP) branches of NPF and P1 - neurons (Wang et - al., 2007; Nicolaï et al., 2010). The P1 neurons that extend processes to - the lateral junction and SMPr arch within the LPC structure were stained with both Denmark - and Syt::eGFP, suggesting that P1 neurons send and receive signals within these neuropils - (Figure 5—figure - supplement 3A, a1-a6). However, in the corresponding lateral junction and SMPr arch - within the LPC region, NPF neurons were labeled with DenMark only (Figure 5—figure supplement - 3B, b1-b3), suggesting that NPF neurons mainly receive signals within this region. The - NPF axons that stained with Syt::eGFP occurred in several brain regions other than the LPC - region (Figure - 5—figure supplement 3B, b1-b6).

            -

            To distinguish the boutons formed - by NPFM neurons from - other NPF neurons, we used the FlpOut approach to specifically label projections of NPFM neurons. We stained - the brains of male UAS > - stop > mCD8::GFP/+;fruFLP/npf-Gal4 flies (Yu et al., 2010) with - anti-GFP and anti-NPF so that the boutons formed by NPFM neurons would be double labeled. We - found that the double-labeled boutons were concentrated in the medial anterior brain, but - not in the lateral superior brain (Figure 5—figure supplement 3C, c1-c6), - indicating that the release site of NPFM neurons was outside the LPC region. - These results demonstrate that NPFM neurons do not directly act on P1 - neurons. Rather, the synaptic connections between NPFM and P1 neurons in the LPC region - are formed by pre-synaptic P1 neurons and post-synaptic NPFM neurons.

            -

            To determine the impact of - activation of P1 neurons on the activity of the NPFM neurons, we combined chemogenetics - and GCaMP imaging to monitor Ca2+ dynamics (Yao et al., 2012) as - an indicator of neural activation. We expressed P2X2 (encoding an ATP-gated cation - channel) (Lima - and Miesenböck, 2005) in P1 neurons, and expressed GCaMP3 in NPF neurons. We used R71G01-LexA, which is - expressed in P1 neurons and a few other neurons, to drive P2X2 expression, and npf-Gal4 to drive UAS-GCaMP3. In a complementary - experiment, we switched the two binary systems, and used the R71G01-Gal4 and npfLexA to drive P2X2 and GCaMP3, respectively. Because the - diffusion rate and final concentration of ATP that reaches the brain varies across samples, - we calculated the maximum fold changes of the GCaMP3 responses after ATP application - relative to the basal levels of GCaMP3 before ATP application. We found that ATP-induced - activation of P1 neurons led to robust GCaMP3 signals in NPFM neurons (Figure 6A—C and Figure 6—figure supplement 1 and - Videos 3 and 4).

            -
              -
            1. -
              -
              -

              - Neural activity changes in NPFM neurons in response to - activation of P1 neurons.

              -

              (A—C) UAS-GCaMP3, LexAop- P2X2/R71G01-LexA;npf-Gal4/+ male - brains were imaged for GCaMP3 responses. Cell bodies of NPFM neurons were imaged. - (A) - Representative heat maps indicating GCaMP3 fluorescence before and during ATP - application. The numbers indicate NPFM neurons. (B) Representative - traces showing dynamic changes in GCaMP3 fluorescence in NPFM neurons (circled in panel - A). (C) Largest GCaMP3 - fluorescence changes [(Fmax-F0)/ F0 (%)] in response to ATP - application in the control and experimental group. GCaMP3 fluorescence was recorded - from 12 NPFM - neurons from eight control brains, and 15 NPFM neurons from nine - experimental brains. (D—F) UAS- P2X2 , LexAop-GCaMP3/R15A01-AD; npfLexA / R 71 G01-DBD male - brains were imaged for GCaMP3 responses. The cell bodies of NPFM neurons were imaged. - (D) - Representative heat maps indicating GCaMP3 fluorescence before and during ATP - application. The numbers indicate NPFM neurons. (E) Representative - traces showing dynamic changes in GCaMP3 fluorescence in NPFM neurons (circled in panel - D). (F) Largest GCaMP3 - fluorescence changes [(Fmax-F0)/ F0 (%)] in response to ATP - application in the control and experimental group. GCaMP3 fluorescence was recorded - from 10 NPFM - neurons from three control brains, and 12 NPFM neurons from three - experimental brains. The scale bars in (A and D) represent 10 μm. The bars in - (C and - F) indicate - means ± SEMs. Significance was assessed using the Mann Whitney test, ***p < - 0.001.

              -

              - 10.7554/eLife.49574.037Figure 6—source data 1.

              -

              Figure 6C Source data.

              -
              -
              - -
              - -
              -
              -
                -
                -

                - 10.7554/eLife.49574.038Figure 6—source data 2.

                -

                Figure 6C Summary statistics.

                -
                -
                - -
                - -
                -
                -
                  -
                  -

                  - 10.7554/eLife.49574.039Figure 6—source data 3.

                  -

                  Figure 6F Source data.

                  -
                  -
                  - -
                  - -
                  -
                  -
                    -
                    -

                    - 10.7554/eLife.49574.040Figure 6—source data 4.

                    -

                    Figure 6F Summary statistics.

                    -
                    -
                    - -
                    - -
                    -
                    -
                      -
                      -
                      -
                      -
                      1. -
                    1. -
                      -
                      -

                      Ca2+ imaging of - NPFM neurons - in response to activation of P1 neurons.

                      -

                      (A) UAS- P2X2,LexAopGCaMP3/+;R71G01-Gal4,npfLexA/+ male brains - were imaged for GCaMP3 responses upon ATP application. Heat maps show the basal and - maximal GCaMP3 fluorescence levels before and during ATP application. The numbers - indicate NPFM - neurons. The scale bar represents 10 μm. (B) Representative traces of - dynamic GCaMP3 fluorescence changes in the NPFM neurons indicated in - (A).

                      -
                      -
                      -
                      2. -
                    +

                    10.7554/eLife.49574.024Figure + 4—source data 2.

                    +

                    + Figure + 4A Summary statistics.

                    @@ -1843,6 +1085,11 @@

                    +

                    10.7554/eLife.49574.025Figure + 4—source data 3.

                    +

                    Figure + 4B Source data.

                    @@ -1854,371 +1101,259 @@

                    -

                    In order to exclude the impact - from other neurons, we expressed P2X2 in P1 neurons only using a split-P1-Gal4 comprised of - R15A01-AD (activation - domain) and R71G01-DBD - (DNA-binding domain). We imaged Ca2+ dynamics in NPFM neurons in response to ATP - application, and detected large increases in GCaMP3 fluorescence in response to activation - of P1 neurons (Figure - 6D—F), further supporting the conclusion that P1 neurons directly activate NPFM neurons.

                    -

                    - Increase in courtship by inhibiting NPFM neurons depends indirectly on P1 - neurons

                    -

                    To determine whether the function - of NPFM neurons in - courtship regulation is dependent on P1 neurons, we tested if silencing P1 neurons would - prevent the courtship elevation induced by disruption of NPF neurons. We expressed UAS-Shits in both NPF and P1 neurons - (npf-Gal4 and R71G01-Gal4) and assayed - male courtship at both permissive and non-permissive temperatures. We found that the - courtship dis-inhibition caused by disrupting NPF neurons was eliminated by simultaneous - disruption of P1 neurons (Figure 7A—C). The results suggest that NPFM neurons appear to act - through P1 neurons to regulate male courtship. Alternatively, NPFM and P1 neurons may act in parallel - and serve opposing inputs onto a common neuronal target.

                    -
                      -
                    1. -
                      -
                      -

                      - Effects of inactivating NPF and P1 neurons on male courtship, characterization of - npfr reporter - expression, and impact of npfr on male courtship.

                      -

                      (A—C) Effects of silencing both - NPF and P1 neurons with Shits (npf-Gal4/+;R71G01-Gal4/UAS-Shits) on courtship of - group-housed males towards female targets. Male-female (M–F) courtship was assayed - at the permissive (23°C) and non-permissive (31°C) temperatures for Shits. (A) The percentages - of males that initiated courtship. n = 4 (6 flies/group). (B) The courtship indexes were - scored based on 20—30 min of observation during a 30 min incubation period. n = 24. - (C) Effect - of silencing both NPF and P1 neurons with Shits (npf-Gal4/+;R71G01-Gal4/UAS-Shits) on male-male (M–M) - courtship. Isolation-housed males were assayed for chaining behavior at 23°C and - 31°C for 10 min. n = 6 (8—12 flies/group). The bars indicate means ± SEMs. - Significance was assessed using the Mann-Whitney test. *p < 0.05, **p < 0.01, - ***p < 0.001. (D—F) Spatial distribution of - npfr (mCherry) and - P1 (GFP) reporters - in a male brain (UAS-mCD8::GFP/+;R71G01-Gal4/npfrLexA,LexAop-mCherry). The reporters - were detected with GFP and DsRed antibodies. The boxed regions indicate the LPC. The - scale bar represents 50 μm. (G) npfrLexA homozygous and - npfrLexA/npfrc01896 - trans-heterozygous mutants were assayed for M–M courtship. The control flies are w1118-CS. n = 12—24. - (H) Effects - on M–M courtship due to knock down of npfr pan-neuronally (elav-Gal4) or in P1 - neurons. n = 21—23. The bars indicate means ± SEMs. To determine significance, we - used the Kruskal-Wallis test followed by the Dunn’s post hoc test. **p < 0.01, - ***p < 0.001.

                      -

                      - 10.7554/eLife.49574.045Figure 7—source data 1.

                      -

                      Figure 7A Source data.

                      -
                      -
                      - -
                      - -
                      -
                      -
                        -
                        -

                        - 10.7554/eLife.49574.046Figure 7—source data 2.

                        -

                        Figure 7A Summary statistics.

                        -
                        -
                        - -
                        - -
                        -
                        -
                          -
                          -

                          - 10.7554/eLife.49574.047Figure 7—source data 3.

                          -

                          Figure 7G—H Source data.

                          -
                          -
                          - -
                          - -
                          -
                          -
                            -
                            -

                            - 10.7554/eLife.49574.048Figure 7—source data 4.

                            -

                            Figure 7G—H Summary statistics.

                            -
                            -
                            - -
                            - -
                            -
                            -
                              -
                              -
                              -
                              -
                              1. -
                            1. -
                              -
                              -

                              npfrLexA mutant.

                              -

                              (A) Schematic of the npfrLexA knock-in - reporter/mutant line generated by CRISPR-HDR and npfrc01896 transposable - element insertion mutant (inverted triangle indicates the transposon insertion - site). (B) - Genotyping using the indicated primers to perform PCR using genomic DNA confirmed - the integration of LexA and the mini-white cassette into the npfr locus. The - control is w1118-CS. - (C) RT-PCR - using RNA and the indicated primers confirmed that the npfr transcripts were disrupted - in the npfrLexA - mutant. RT-PCR amplification of rp49 from the control (w1118-CS) and npfrLexA served as a - control for the quality of the RNA.

                              -
                              -
                              -
                              2. -
                            -

                            NPF binds to a G protein-coupled - receptor—the NPF receptor (NPFR), which couples to a Gi signaling pathway to inhibit npfr-expressing neurons - (Garczynski et - al., 2002). To address the roles of the npfr gene and NPFR neurons in regulating - male courtship, we replaced a portion of the npfr coding region with LexA, thereby generating an npfr mutant and a reporter - (Figure 7—figure - supplement 1). We then used the R71G01-Gal4 and npfLexA/+ to label P1 neurons and - NPFR neurons with GFP and mCherry, respectively. We found that they primarily stain distinct - neuronal populations (Figure 7D—F), indicating that P1 neurons are - not the npfr-expressing - neurons. These results further support our data suggesting that NPFM axons do not send signals directly - to P1 dendrites, but that P1 neurons signal to NPFM neurons.

                            -

                            We assayed courtship behavior of - npfrLexA mutant flies, - demonstrating that these mutant animals raised in isolation exhibit significantly higher - M–M courtship than control males (Figure 7G). We observed similar results with - npfrLexA/npfrc01896 trans-heterozygous - flies (Figure 7G). - RNAi-mediated knockdown of npfr using a pan-neuronal Gal4 (elav) also increased M–M courtship - behavior (Figure - 7H). In contrast, knocking down npfr expression in P1 neurons had no - effect (Figure 7H). -

                            -

                            We took advantage of the GRASP - method to investigate whether NPFR and P1 neurons make direct connections. We used R71G01-Gal4 and npfrLexA drivers to express - spGFP1-10 and spGFP11 respectively. We detected GRASP signals in the lateral crescent within - the LPC region of the male brain (Figure 8A,a1,a2). In contrast, we did not - detect GRASP GFP fluorescence in female brains or in control male brains (Figure 8B,b1,b2 and Figure 5I).

                            -
                            - 10.7554/eLife.49574.026Figure + 4—source data 4.

                            +

                            + Figure + 4B Summary statistics.

                            +
                            +
                            + +
                            + +
                            +
                            +
                              +
                              +

                              10.7554/eLife.49574.027Figure + 4—source data 5.

                              +

                              Figure 4F Source + data.

                              +
                              +
                              + +
                              + +
                              +
                              +
                                +
                                +

                                10.7554/eLife.49574.028Figure + 4—source data 6.

                                +

                                + Figure + 4F Summary statistics.

                                +
                                +
                                + +
                                + +
                                +
                                +
                                  +
                                  +
                                  +
                                  +

                                  To activate NPFM neurons, we employed a similar FlpOut + approach, using UAS > stop + > trpA1/npf-Gal4; fruFLP/ +flies, to express the + thermally-activated TRPA1-A isoform in NPFM neurons only. This TRPA1 isoform is a + Na+ and Ca2+-permeable channel, which + is activated at temperatures above ~ 27 °C (Viswanath et al., 2003). + To perform these assays, we used decapitated females since intact females stimulate ceiling + levels of male courtship, which are resistant to down-regulation, while decapitated females + induce moderate levels, which facilitate detecting subtle decreases in male courtship. We found + that courtship levels in UAS > + stop > trpA1/npf-Gal4;fruFLP/+ males were suppressed at + 29°C relative to 23°C (Figure 4B). In contrast, none of the three types + of control flies exhibited lower male courtship at 29°C (Figure 4B). Nevertheless, because the CI exhibited + by the UAS > stop + > trpA1/npf-Gal4;fruFLP/+ males at 29°C was not + elevated relative to the CIs displayed by the control males at 29°C, the results preclude the + conclusion that activation of sexually dimorphic NPFM neurons inhibits male courtship.

                                  +

                                  To test whether the NPF produced in + NPFM neurons is + responsible for inhibiting male courtship, we knocked down NPF expression in distinct groups of + neurons. To conduct these experiments, we used UAS-npf-RNAi, which was effective as it + greatly reduced NPF levels (Figure 4C—E). We found that knocking down npf expression with the fru-Gal4 induced a dramatic + increase in M–M courtship, and did so to a similar extent as when we used a pan-neuronal (elav) Gal4 or the npf-Gal4 (Figure 4F).

                                  +

                                  To specifically interrogate a + requirement for NPF in NPFM neurons, we used FlpOut to introduce + Gal80 (which binds and + inhibits Gal4 activity) in + either fru+ or fru- neurons, thereby confining UAS-npf-RNAi expression to fru- NPF neurons or NPFM neurons, respectively. To knockdown npf specifically in NPFM neurons, we used the + following flies that cause excision of Gal80 in fru neurons only, thereby allowing Gal4 expression and RNA + knockdown in NPFM + neurons: npf-Gal4/tub > Gal 80 + >stop;UAS-npf-RNAi/fruFLP flies. Conversely, to prevent + npf knockdown in NPFM neurons, we expressed Gal80 specifically in these + neurons using npf-Gal4/tub > stop > + Gal80;UAS-npf-RNAi/fruFLP flies. We found + that knocking down npf + exclusively in NPFM + neurons elevated M–M courtship while npf knock down in fru- NPF neurons did not change the level of + male courtship (Figure + 4F). These results indicate that sexually dimorphic NPFM neurons are the subset of NPF neurons + that are exclusively required for suppressing male courtship, and the effect is dependent on NPF + produced in NPFM neurons. +

                                  +

                                  P1 neurons directly activate NPFM neurons

                                  +

                                  To address how NPFM neurons are integrated into the fru circuit, we adopted the + GRASP (GFP Reconstitution Across Synaptic Partners) (Feinberg et al., 2008; + Gordon and Scott, + 2009) method to detect potential contact loci between NPF neurons and fru neurons. This approach + employs a dual binary expression system to synthesize two complementary but non-functional parts + of GFP (spGFP1-10 and spGFP11) on the cell membranes of distinct neurons. When the neurons are + in close proximity, GFP is reconstituted and fluorescence is produced. We expressed spGFP1-10 + and spGFP11 in fru and NPF + neurons, respectively and detected strong bouton-shaped GFP signals in the male brain (Figure 5A) but only + sparse signals in the female brain (Figure 5B) and no specific reconstituted GFP + signals in control male brains missing the driver for the LexAop-spGFP11 (Figure 5C). The reconstituted GFP signals in the + male brain reconstruct a distinctive male-specific brain structure – the lateral protocerebral + complex (LPC), which includes several neuropils: the lateral junction, superior medial + protocerebrum (SMPr) arch, lateral crescent and the ring structure (Figure 5—figure supplement 1A) (Yu et al., + 2010). The LPC structure is formed by neural projections from a cluster of + male-specific P1 neurons which function as the integrative hub controlling male courtship + behavior (Kimura et + al., 2008; Yu et al., 2010; Kohatsu et al., 2011; + von Philipsborn et + al., 2011; Pan et al., 2012; Bath et al., 2014; Inagaki et al., + 2014; Clowney et al., 2015; Kallman et al., 2015; + Zhou et al., + 2015; Zhang et al., 2016).

                                  +
                                    +
                                  1. +
                                    +

                                    Anatomical - and physiological interactions between NPFR and P1 neurons.

                                    + id="anatomical-and-functional-interactions-between-p1-and-npfm-neurons">Anatomical and + functional interactions between P1 and NPFM neurons.

                                    (A and B) GRASP analyses to test for - close associations between npfr and P1 neurons. UAS-spGFP1-10,A—C) GRASP approach to examine + close interactions between NPF and fru neurons in UAS-spGFP1-10, LexAop-spGFP11/R71G01-Gal4,npfrLexA male and female - brains were imaged for reconstituted GFP signals. (NP21-Gal4, npfLexA flies. GFP + fluorescent signals indicate close associations. (A) Reconstituted GFP signals in a - male brain. The boxes indicate the higher magnification images (a1 and a2) showing the - bouton-shaped GFP signals in the lateral crescent within the LPC. (B) Reconstituted GFP signals in a - female brain. The boxes indicate the zoomed in areas (b1 and b2) showing the lateral - regions of the female brain, corresponding approximately to the lateral crescent regions - in the male brain. The scale bars represent 50 μm in (A and B), and 10 μm in a1—a2 and b1—b2. A - portion of the brain stacks, including the LPC structure, is shown. The full brain - stacks are presented in the source data files. (C—E) Assaying effects on P1 - neuronal activity with GCaMP3, after stimulating npfr neurons with ATP. GCaMP3 and P2X2 were expressed - specifically in P1 and npfr neurons, respectively, in the - following flies: UAS-GCaMP3, LeAop P2X2/+;R71G01-Gal4/npfrLexA. GCaMP3 responses - were imaged in the LPC structures in male brains. (C) Representative heat maps - indicating GCaMP3 fluorescence before and during ATP application. The numbers indicate - the regions within the LPC structure measured. (D) Representative traces showing - dynamic fluorescence changes in the specified regions circled in (C). (E) Maximal fluorescence increases - [(Fmax-F0)/ F0 (%)] in response to ATP - application. GCaMP3 fluorescence was recorded from 25 regions from five control brains, - and 22 regions from four experimental brains. The scale bar in (C) represents 50 μm. The bars in - (E) indicate - means ± SEMs. To determine significance, we used the Mann Whitney test. ***p < 0.001. - (F) A model - illustrating the feedback loop of NPFM neurons in the regulation of P1 - neuronal activity. (G) Illustration of a feedforward - parallel model, in which target neurons (X neurons) receive parallel input from P1 - neurons and NPFR neurons.

                                    -

                                    10.7554/eLife.49574.050Figure - 8—source data 1.

                                    -

                                    Figure - 8E Source data.

                                    -
                                    -
                                    - -
                                    - -
                                    -
                                    -
                                      -
                                      -

                                      10.7554/eLife.49574.051Figure - 8—source data 2.

                                      + male brain. The arrows indicate the SMPr arch and lateral junction structures. (B) Reconstituted GFP + signals in a female brain. (C) Negative control for GRASP + showing a UAS-spGFP1-10, LexAop-spGFP11/NP21-Gal4 male brain. Scale bars + indicate 50 μm. A portion of the brain stacks, including the LPC structure, is shown. + The full brain stacks are presented in the source data files. (D—F) FlpOut approach to + differentially label P1 neurons and NPFM neurons. (D) Anti-GFP stained fru-positive P1 (due to + smGdP expression) and + NPFM neurons. + Arrows indicate the SMPr arch and the lateral junction. Arrowheads indicate the soma of + NPFM neurons. + (E) Anti-V5 + exclusively labels NPFM neurons. The arrowheads + indicate soma of NPFM neurons. (F) Composite of P1 and NPFM neurons. The + arrowheads indicate NPFM soma. The scale bar represents + 50 μm. (G—I) + GRASP approach to examine close interactions between NPF and P1 neurons in UAS-spGFP1-10,LexAop-spGFP11/R71G01-Gal4,npfLexA flies. GFP + fluorescent signals indicate close associations. (G) Reconstituted GFP signals in a + male brain. Arrows indicate lateral junction and SMPr arch of the LPC. The arrowhead + indicates an example of a reconstituted GFP signal. (H) Reconstituted GFP signals in a + female brain. (I) Negative control for GRASP + showing a UAS-spGFP1-10, LexAop-spGFP11/R71G01-Gal4 male brain. Scale bars + indicate 50 μm. A portion of the brain stacks, including the LPC structure, is shown. + The full brain stacks are presented in the source data files.

                                      +

                                      10.7554/eLife.49574.033Figure + 5—source data 1.

                                      Figure 8E Summary statistics.

                                      -
                                      -
                                      - -
                                      - -
                                      -
                                      -
                                        -
                                        -

                                        10.7554/eLife.49574.052Figure - 8—source data 3.

                                        -

                                        Figure - 8A—B Full stacks.

                                        + id="figure-5ac-gi-full-stacks">Figure 5A—C, G—I Full stacks.
                                        @@ -2232,1486 +1367,309 @@

                                        To examine whether activation of - NPFR neurons affects the activity of P1 neurons, we expressed P2X2 in NPFR neurons, and GCaMP3 in P1 neurons. We - found that activation of NPFR neurons with ATP application induced robust GCaMP3 responses - in the LPC structure (Figure 8C—E and Video 5). In control flies that did not - express P2X2 , application - of ATP did not induce elevation of GCaMP3 fluorescence (Figure 8E). The preceding results indicate - that at least a subset of NPFR neurons anatomically connect and functionally activate P1 - neurons. Together, our results indicate that NPFM, NPFR and P1 neurons form intricate - interactions, and ensure proper courtship output in accordance with a male’s internal drive - state.

                                        -
                                        -
                                        - -
                                        - -
                                        -
                                        -
                                          +

                                          1. +
                                        1. +
                                          +
                                          +

                                          + Cartoons of male brains showing the approximate positions of selected brain regions and + neurons.

                                          +

                                          (A) Schematic illustration of the + LPC structure formed by P1 neuronal processes. Lateral junction, SMPr arch, lateral + crescent and ring of the LPC are indicated. (B) Schematic illustration of + NPFM neurons. + (C) Schematic + illustration of composite of NPFM neurons and LPC structure.

                                          +
                                          +
                                          +
                                          2. +
                                        2. +
                                          +
                                          +

                                          + Comparison of the projection patterns of NPF and P1 neurons in a male brain.

                                          +

                                          (A—C) UAS-mCD8::RFP,LexAop-mCD8::GFP/+,Y;;R71G01-GAL4/npfLexA male and female + brains immunostained with anti-GFP and anti-DsRed (stains RFP), which labels NPF and P1 + neurons, respectively. (A—C) RFP and GFP expression patterns in a male + brain. The boxed regions indicate the LPC. NPFM neurons are indicated by the + arrows. (D—F) + RFP and GFP expression patterns + in a female brain. Scale bars indicate 50 μm.

                                          +
                                          +
                                          +
                                          3. +
                                        3. +
                                          +
                                          +

                                          Directionality of + connections between P1 and NPFM neurons.

                                          +

                                          (A) Pre- and post-synaptic regions + of P1 neurons were labeled with Syt::eGFP and DenMark, respectively in a male brain from + a UAS-DenMark,UAS-Syt::eGFP/+;R71G01-Gal4/+fly. + DenMark and Syt::EGFP were detected with anti-DsRed and anti-GFP, respectively. The + boxes indicate the lateral junction and SMPr arch of the LPC, which are contoured in + a1—a6. (B) Pre- + and post-synaptic regions of NPF neurons were labeled with Syt::eGFP and DenMark, + respectively in an npf-Gal4/UAS-DenMark,UAS-syt::eGFP male brain. The box to + the left shows the LPC region (contoured in b1 —b3). The box to the right shows the + medial anterior brain. Bouton-shaped syt::eGFP signals in this region are contoured in + b4—b6. (C) npf-Gal4/ UAS > stop > mCD8::GFP;fruFLP/+ male + brain stained with anti-NPF and anti-GFP. The left box outlines the LPC region, which is + contoured in (c1 + —c3). The right + box shows boutons that are double-stained with both antibodies in the medial anterior + brain, and contoured in (c4 —c6). The scale bars represent 50 μm + in panels (A + —C), and 20 μm + in panels (a1 + —a6), (b1 —b6) and (c1 —c6).

                                          +
                                          +
                                          +
                                          4. +
                                        +

                                        To compare the projection patterns of + NPF and P1 neurons, we expressed GFP and RFP in NPF and P1 neurons, respectively, using two + binary expression systems. We found that the projections from NPF neurons overlapped with the + LPC structure in the male brain (Figure 5—figure supplement 2A—C). However, the + female brain does not include an LPC structure (Figure 5—figure supplement 2D—F). We further + combined the FlpOut method and dual binary expression systems to exclusively label NPFM and P1 neurons, and found + that the projections from these two clusters of neurons overlapped intensely in LPC region (Figure 5D—F and Figure 5—figure supplement + 1 and Video 2). +

                                        +
                                        +
                                        + +
                                        +
                                        -

                                        Discussion

                                        -

                                        Multiple studies report the - contribution of external sensory cues in inducing or suppressing male courtship behavior by - signaling onto the P1 courtship decision center in the male brain (Kimura et al., 2008; - Yu et al., - 2010; Kohatsu et al., 2011; von Philipsborn et al., - 2011; Pan et al., 2012; Bath et al., 2014; - Inagaki et al., - 2014; Clowney et al., 2015; Kallman et al., 2015; - Kohatsu and - Yamamoto, 2015; Zhou et al., 2015). In contrast, much less is known about how - the P1 neurons are regulated by the male’s prior mating experience (Inagaki et al., 2014) - and how courtship is affected by the internal drive state. An exception is a recent study - that identified a group of dopaminergic neurons that changes in activity in proportion to - male mating drive, and which directly activates P1 neurons to promote male courtship (Zhang et al., - 2016). In the current study, we characterized a cluster of male-specific - NPFM neurons which - functions antagonistically to dopamine neurons by serving to suppress courtship by - responding to sexual satiation. Disruption of NPFM neurons causes dis-inhibition of - courtship in satiated males. The internal drive state of males is encoded by opposing - excitatory and inhibitory inputs, which enable a male to make an appropriate mating decision - in accordance with its internal drive state.

                                        -

                                        Suppression - of NPF neurons or elimination of npf counters sexual satiation

                                        -

                                        Elimination of npf or knocking down npf expression exclusively in - male-specific NPFM - neurons causes male flies to exhibit maladaptive, hypersexual activity. In contrast to - control males, which are sexually satiated when exposed to an abundance of females, and - consequently display very low courtship levels, we found that flies overcome the sexual - satiation imposed by mating if we introduce a loss-of-function mutation in npf or inhibit NPF neurons. Thus, - satiation of courtship is dis-inhibited by disrupting NPF signaling.

                                        -

                                        Our findings that suppressing or - eliminating NPF neurons elevates male courtship is in contrast to a previous report that - genetic disruption or feminization of NPF neurons reduces male courtship activity (Lee et al., - 2006). Maintaining males in the presence or absence of females profoundly - affects sexual satiation levels, and the housing conditions were not clearly defined in this - previous study. Our conclusions are supported by multiple lines of evidence. First, we found - that when we inhibit neurotransmission from NPF neurons, using a temperature sensitive - dynamin (Shits), the males showed a - dramatic increase in courtship towards female conspecifics. This occurred using group-housed - males which normally are sexually satiated. Second, introduction of a genetically encoded - toxin, or inhibition of NPF neurons by overexpression of a K+ channel, also increases courtship - activity. Third, when we disrupted the npf gene, the mutant males displayed a - remarkable increase in courtship. This effect was so profound that the males courted females - of another species and also displayed a great increase in M–M courtship, even though their - gender preferences remained unchanged. Fourth, disruption of the npfr gene resulted in significant - elevation in courtship, consistent with the effect of disrupting npf. Fifth, when we specifically silenced - male-specific fru+ NPF (NPFM) neurons, male - courtship behavior was elevated. In contrast, silencing fru- NPF neurons had no impact on male - courtship. Sixth, knocking down npf expression exclusively in NPFM neurons increased male - courtship, while knocking down npf in fru- NPF neurons had no effect.

                                        -

                                        Neuronal circuit - models entail P1 neurons activating NPFM neurons

                                        -

                                        Our anatomical, physiological and - functional evidence demonstrate that P1 neurons activate NPFM neurons, and suggest potential - models through which these neurons coordinate to regulate male courtship drive. According to - one model, P1 and NPFM neurons form a recurrent inhibitory - neuronal circuit (Figure 8F). Stimulation of P1 neurons - activates NPFM - neurons, which act through an intermediate group of NPF receptor (NPFR neurons) and feedback - to inhibit P1 neurons. This recurrent inhibitory model posits that P1 neurons are strongly - activated when males are exposed to many females, inducing NPFM neurons to release NPF. This - neuropeptide acts on the Gi-coupled NPF receptor and inhibits - NPFR neurons, leading to a suppression of P1 activity, and attenuation of male courtship. - When the activity of P1 neurons is reduced, stimulation of NPFM neurons and NPF release are - diminished. This attenuates the feedback inhibition from NPFM to P1 neurons, leading to a return - of P1 neuronal activity, and male courtship drive.

                                        -

                                        We suggest that the recurrent - inhibitory neuronal motif proposed here is important for maintaining proper activities of P1 - neurons, thus ensuring appropriate behavioral choices that are critical for a male’s - reproductive success, depending on the level of sexual satiety. Because P1 neurons integrate - multi-modal sensory input, as well as the male’s internal level of sex drive (Kohatsu et al., - 2011; Pan et al., 2012; Bath et al., 2014; - Inagaki et al., - 2014; Clowney et al., 2015; Kallman et al., 2015; - Kohatsu and - Yamamoto, 2015; Zhou et al., 2015; Zhang et al., 2016), - their activity must be under stringent control so that males display the courtship ritual - only when both external sensory cues and the internal drive states are appropriate.

                                        -

                                        The recurrent inhibitory neural - motif proposed here is dedicated to ensure appropriate activation of P1 neurons. Disruption - of the inhibitory NPF afferents leads to excessive courtship behavior in the male fly that - is maladaptive, as it overrides the courtship inhibition normally imposed by recent mating - with females, other males, or females of other Drosophila species.

                                        -

                                        Recurrent inhibitory neural - motifs are important in the central nervous system. In the mammalian spinal cord, motor - neurons send collateral branches to Renshaw cells, which in turn send inhibitory signals - back to motor neurons (Alvarez and Fyffe, 2007). The function of this recurrent - inhibition is assumed to restrict excessive activation of motor neurons and contribute to - precise recruitment of muscle fibers in order to generate proper force for different tasks - (Alvarez and - Fyffe, 2007). Recurrent inhibitory loops also occur in the hippocampus and - entorhinal cortex. In these systems, principal cells send excitatory outputs to - fast-spiking, parvalbumin-positive interneurons, and at the same time receive inhibitory - inputs from these interneurons, thus, closing the feedback inhibition loop (Pouille and - Scanziani, 2004; de Almeida et al., - 2009; Pastoll et al., 2013).

                                        -

                                        While NPFM, P1 and NPFR neurons are essential - for regulating courtship by responding to prior mating experience, and may do so through a - recurrent inhibitory loop (Figure 8F), our data do not exclude other - models. Part of the argument in favor of the recurrent inhibitory loop model is that the - GRASP analysis suggests that NPFR neurons make direct connections with P1 neurons. Moreover, - by coupling chemogenetic manipulation and Ca2+ imaging, we found that activation - of NPFR neurons activate P1 neurons. However, NPFR neurons are widely distributed, and our - data do not resolve whether the NPFR neurons that activate P1 neurons are the same subset of - NPFR neurons that are the direct downstream target of NPFM neurons. Thus, one alternative to - the recurrent inhibitory motif is a feedforward parallel model, in which target neurons (X - neurons) control courtship drive by receiving parallel input from P1 neurons and NPFR - neurons (Figure - 8G). This latter model posits that P1 neurons activate X neurons, and at the same - time, send axonal branches to activate NPFM neurons, which then act through - NPFR neurons and suppress the target neurons through a feedforward mechanism. Future - experiments that resolve the anatomical and functional diversity of NPFR neurons should - distinguish between the recurrent inhibitory versus feedforward parallel model, which ensure - proper courtship output in accordance with a male’s internal drive state.

                                        -

                                        Impact of NPF activity on - courtship versus aggression

                                        -

                                        Courtship and aggression are - closely interrelated social behaviors. If males are housed in isolation, they exhibit - elevated courtship and aggression (Wang et al., 2008; - Liu et al., - 2011). This positive relationship is consistent with the observation that the - presence of a potential mate promotes a male fly’s propensity to fight a competitor to win a - mating competition (Kravitz and Fernandez, 2015). Though the tendency to fight or - to court is positively related, the behavioral choice between courtship and aggression is - mutually exclusive.

                                        -

                                        We found that when we disrupt the - activity of NPF neurons, M–M courtship is dominant over aggression. We suggest that loss of - NPF function diminishes inhibition of P1 neurons. As a result, even sub-optimal stimuli - strongly activate P1 neurons and induce male courtship behavior even towards inappropriate - targets. Conversely, when we increase the activity of NPF neurons or over-express the npf-cDNA in NPF neurons, - M–M aggression is dominant over courtship.

                                        -

                                        The precise contribution of NPF - neurons in regulating aggression is unresolved. One group found that activation of NPF - neurons elevates male aggression (Asahina et al., 2014) - while another reported that silencing or feminizing NPF neurons elevates aggression (Dierick and - Greenspan, 2007). We found that when we overexpressed either the Na+ channel NaChBac or the - npf-cDNA in NPF neurons, - the males exhibited increased aggression. We propose that excessive NPF activity suppresses - P1 neurons, thereby setting a high threshold for P1 activation. Our observations are - consistent with previous report that weaker activation of P1 neurons favors aggression while - stronger activation of P1 neurons favors courtship (Hoopfer et al., 2015). - It remains to be determined if NPF neurons also impact on the aggression modulatory or - arousal center (Asahina et al., 2014; Watanabe et al., - 2017), independent of its effect on P1 neurons.

                                        -

                                        Possible - relationship of NPF to courtship regulation by mammalian NPY

                                        -

                                        NPF is the Drosophila counterpart of mammalian NPY, - which regulates feeding, reproduction, aggression, anxiety, depression and the alcohol - addiction (Nässel and Wegener, 2011). Previous studies indicate that - sexually dimorphic NPY neurons innervate the human INAH3 (interstitial nuclei of anterior - hypothalamus 3), a region correlated with sexual orientation and gender identity recognition - (LeVay, - 1991; Byne et al., 2000; Garcia-Falgueras and Swaab, - 2008). The discovery that Drosophila NPF regulates courtship - depending on the internal drive state raises questions as to whether NPY may serve similar - functions in mammals.

                                        -

                                        - Materials and methods

                                        -

                                        Key resources -

                                        -

                                        Descriptions of the key fly - strains, antibodies, plasmids, chemicals, kits, services and software are provided in the Supplementary file - 1.

                                        -

                                        Fly stocks

                                        -

                                        The following strains were - obtained from Bloomington Stock Center (Indiana University): npf-Gal4 (#25681, and #25682 have - identical promoters, but are inserted on the 2nd and 3rd chromosomes, respectively), elav-Gal4 (#8765), fru-Gal4 (NP21 #30027), R71G01-Gal4 (P1-Gal4 #39599), R71G01-LexA (P1-LexA #54733), UAS-NaChBac (#9468), UAS-Kir2.1 (#6596), UAS-DTI (#25039), UAS-mCD8::GFP (#5137), UAS-npf-RNAi (VDRC108772), - UAS-npfr-RNAi - (VDRC107663), UAS-DenMark,UAS-syt::eGFP (#33064), LexAop-mCherry (#52271), LexAop(FRT.mCherry)ReaChR-mCitrine (#53744), UAS-IVS-mCD8::RFP, LexAop-mCD8::GFP (#32229), - UAS-CD4-spGFP1-10,LexAop-CD4-spGFP11 (#58755), - LexAop-IVS-CsChrimson.mVenus (#55139), - Lexop(FRT.stop)myr::smGdP-V5 (#62107) npfrc01896 (#10747), tub(FRT.Gal80)stop (#38880), - tub(FRT.stop)Gal80 - (#38878).

                                        -

                                        UAS-npf was a gift from Dr. Ping Shen - (Wu et al., - 2003) (University of Georgia), UAS- P2X2,LexAop-GCaMP3 and UAS-GCaMP3, LexAop P2X2 were from Dr. Orie Shafer - (Yao et al., - 2012) (University of Michigan), UAS-Shibirets was from Dr. Christopher - Potter (Kitamoto, 2001) (Johns Hopkins University School of Medicine), - fruFLP, UAS-(FRT.stop)mCD8::GFP, UAS-(FRT.stop)Shibirets and UAS-(FRT.Shibirets)stop, UAS-(FRT.stop)dTRPA1 were from Dr. Barry Dickson (Yu et al., - 2010) (Janelia Research Campus), R71G01-DBD;R15A01-AD was from Dr. David - Anderson (California Institute of Technology).

                                        -

                                        The npfLexA and npfrLexA mutants were outcrossed - into a w1118 background for five - generations. The controls for comparison to these mutants were w1118 flies in which we - exchanged the X chromosome with Canton-S so the flies are w + on the X chromosome (w1118-CS flies). The full - genotypes of the flies used in each figure and video are listed in Supplementary file 2.

                                        -

                                        Behavioral - assays

                                        -

                                        The behavioral assays were - recorded using a Samsung SCB-3001 camera. All behavioral analyses were performed using these - videos.

                                        -

                                        - M–F, and M–M courtship assays

                                        -

                                        To perform courtship assays, we - added 3 ml of 1.5 % agarose into each well of 24-well cell culture plates (Corning - Incorporated, REF353847). 2 mm diameter holes were drilled on the cover over each well. - Custom silicone plugs were prepared (435570, StockCap) for blocking the holes. The cover and - the plate were taped together to avoid gaps that might allow flies to escape.

                                        -

                                        Unless otherwise specified, 5—7 - days old mixed sex, group-housed males (10 males raised together with 30 virgin w1118 females for 3 days) were - used for the courtship assays. Three types of female targets were used: 1) mature active - females, 2) newly-eclosed females, or 3) decapitated females. In experiments in which the - targets were either grouped-housed w1118 males or Drosophila simulans females, we used 5—7 - day old isolation-housed males as the testers. One tester male and one target were ice - anesthetized, and transferred together into courtship chambers. The flies were allowed to - recover for 10 min, and then male courtship was scored over the next 10 min. The courtship - index is the fraction of time that a tester male performs courtship towards the target.

                                        -

                                        To test the effects of inhibiting - npf neurons with Shits, a single tester male (npf-Gal4/+;UAS-Shits/+) and a target female - (mature, active w1118, 5—7 days - old) were ice-anesthetized, and the pair was transferred into courtship chambers. The assays - were performed at 23°C and 31°C, which are the permissive and non-permissive temperatures - for Shits, respectively. Courtship - indexes were calculated based on 20—30 min observation during a 30 min incubation period. -

                                        -

                                        Male - chaining assays

                                        -

                                        We inserted newly-eclosed tester - males into individual vials, and aged them for 5—7 days. We introduced 8—12 males into a 35 - mm Petri dish, which was filled with 8 ml 1.5% agarose through a 2 mm diameter hole drilled - on the cover. We allowed the flies to recover for 5 min, and then determined the ratio of - time over the next 10 min in which ≥ 3 flies engaged in simultaneous courtship (chaining - index).

                                        -

                                        M–M - aggression assay

                                        -

                                        The aggression assays were - carried out as described previously (Zhou et al., 2008), - using 5—7 day-old isolation-housed tester males, and 5—7 days group-housed w1118 males as the targets. - Briefly, one tester was paired with one target in the assay. The custom-designed chambers - were based on previous reports (Zhou et al., 2008; - Liu et al., - 2011), and were fabricated by the Physics Machine Shop at UCSB (Figure 1—figure - supplement 3). The chamber consists of two concentric circular chambers. The outer - chamber diameter and height are 13 mm and 7 mm, respectively. The inner chamber diameter and - height are 8 mm and 3.5 mm, respectively. The outer and inner chambers are separated by 0.5 - mm thick, 3.5 mm high walls. 0.3 ml standard corn meal and molasses fly food was added to - the inner chamber. 1.5% agarose was used to fill the space between inner and outer chambers. - The heights of the food and agarose patches were the same (3.5 mm). We then dissolved 15% - sucrose and 15% yeast in apple juice, and added 15 μl liquid to each food patch. Once the - liquid mixture has soaked into the food, and the patch is dry at the surface, the aggression - chamber is ready to use. w1118 male targets - were transferred to the chamber by ice-anesthetization. A 22 × 22 mm microscope cover glass - (Fisher Scientific) was used to cover to the chamber. The targets were allowed to recover - for 10 min, and the isolation-housed tester males were introduced into the chamber by gentle - tapping. After waiting 5 min for the tester males to recover, we scored the number of lunges - during the following 15 min.

                                        -

                                        Male and female preference assay

                                        -

                                        To test the preference of a male - tester for females versus males, we placed one decapitated w1118 virgin female and one - decapitated w1118 male in a courtship - chamber. The tester males were isolation-housed for 5—7 days since eclosion, and transferred - into the chamber by gentle tapping. After 5 min recovery time, we scored the time during - which the tester male performed courtship behavior towards either the decapitated female or - the decapitated male target over the course of 10 min. The preference index is the ratio of - time that male testers spend courting decapitated female targets out of the total courtship - time.

                                        -

                                        Molecular - biology

                                        -

                                        - Generation of npf1 strain

                                        -

                                        To generate the npf1 allele (Figure 1E) we used the CRISPR - mediated NHEJ (clustered regularly interspaced short palindromic repeats – non-homologous - end joining) method (Kondo and Ueda, 2013; Ren et al., 2013).

                                        -

                                        We designed the following - oligonucleotides:

                                        -
                                          -
                                        • -

                                          npf-gRNA1-f: 5’ - CTTCGCCCTTGCCCTCCTAGCCGC 3’

                                          -
                                          • -
                                        • -

                                          npf-gRNA1-r: 5’ - AAACGCGGCTAGGAGGGCAAGGGC 3’

                                          -
                                          • -
                                        • -

                                          npf-gRNA2-f: 5’ - CTTCGTTGCCATGGTCGTCTAAAA 3’

                                          -
                                          • -
                                        • -

                                          npf-gRNA2-r: 5’ - AAACTTTTAGACGACCATGGCAAC 3’

                                          -
                                          • -
                                        -

                                        We annealed the oligonucleotides - to obtain two independent dimers, and ligated the primer dimers into the BbsI site of - pU6-BbsI-ChiRNA BbsI (Addgene #45946). The pU6-BbsI-npf-gDNA1 and the pU6-BbsI-npf-gDNA2 plasmids were - co-injected into the BDSC strain #51324 as the Cas9 source (BestGene Plan R). Based on DNA - sequencing, we found that npf1 harbored a single nucleotide - frameshift deletion that changed the 2nd position of codon 19.

                                        -

                                        - Generation of npfLexA strain

                                        -

                                        To generate the npfLexA line with an insertion of - the LexA reporter (Figure 1D), we used - the CRISPR-HDR (clustered regularly interspaced short palindromic repeats – homology - directed repair) method (Kondo and Ueda, 2013; Ren et al., 2013). We - chose upstream and downstream guide RNAs that targeted the npf coding sequences using the CRISPR - Optimal Target Finder: http://tools.flycrispr.molbio.wisc.edu/targetFinder/. -

                                        -

                                        We annealed the following - upstream and downstream primer dimers, which we inserted into the BbsI site of - pU6-BbsI-ChiRNA (Addgene #45946).

                                        -
                                          -
                                        • -

                                          npf_up_ChiRNA_F: 5’ - CTTCCCAAACAATGCGTTGCATCC 3’

                                          -
                                          • -
                                        • -

                                          npf_up_ChiRNA_R: 5’ - AAACGGATGCAACGCATTGTTTGG 3’

                                          -
                                          • -
                                        • -

                                          npf_down_ChiRNA_F: 5’ - CTTCAGATTTATGTTACAGGCTCG 3’

                                          -
                                          • -
                                        • -

                                          npf_down_ChiRNA_R: 5’ - AAACCGAGCCTGTAACATAAATCT3’

                                          -
                                          • -
                                        -

                                        We amplified the npf upstream (1359 bp, nucleotides 3 - R:16609779 to 16611137, release = r 6.16) and downstream (1388 bp, nucleotides 3 R:16610753 - to 16612140, release = r 6.16) homology arms using the following primers:

                                        -
                                          -
                                        • -

                                          npf_LA_KpnI_F: 5’ - GACGCATACCAAACGGTACCCATTGTGACACCGTTGCGCTTTCCA 3’

                                          -
                                          • -
                                        • -

                                          npf_LA_KpnI_R: 5’ - TTTTGATTGCTAGCGAGTTCTATAAATGGCTAATGTATGT 3’

                                          -
                                          • -
                                        • -

                                          npf_RA_NdeI_F: 5’ - CTAGGCGCGCCCATATGTCGCGGTTTTAATGAGGAGGAGATATTC 3’

                                          -
                                          • -
                                        • -

                                          npf_RA_NdeI_R: 5’ - GACAAGCCGAACATATGATCGGACTTGGACGTGGTAAGCCAA 3’

                                          -
                                          • -
                                        -

                                        We used the In-Fusion cloning kit - (Clontech) to clone the upstream and downstream homology arms into the KpnI and NdeI sites - of pBPLexA::p65Uw (Addgene - #26231), respectively.

                                        -

                                        The pU6-BbsI-ChiRNA-npf_up, pU6-BbsI-ChiRNA-npf_down, and pBPLexA::p65Uw-npf_LA + RA - plasmids were injected into the BDSC #51323 strain, which provided the source of Cas9 - (BestGene Plan R).

                                        -

                                        We used the following primers to - genotype the transformants (as shown in Figure 1—figure supplement 2A):

                                        -
                                          -
                                        • -

                                          npf[LexA]LA_GT_F (P1): 5’ - CTTTCGGCCAACATTTATTCACG 3’

                                          -
                                          • -
                                        • -

                                          npf[LexA]LA_GT_R (P2): 5’ - AAAGCCCAGTCGCTGTGCTATCT 3’

                                          -
                                          • -
                                        • -

                                          npf[LexA]RA_GT_F (P3): 5’ - TCAAATACCCTTGGATCGAAGTA 3’

                                          -
                                          • -
                                        • -

                                          npf[LexA]RA_GT_R (P4): 5’ - AGGGCTGCTGTAAGTATCGGTTG 3’

                                          -
                                          • -
                                        • -

                                          npf_Deletion_F (P5): 5’ - CTTCCCAAACAATGCGTTGCATCC 3’

                                          -
                                          • -
                                        • -

                                          npf_Deletion_R (P6): 5’ - AAACCGAGCCTGTAACATAAATCT 3’

                                          -
                                          • -
                                        -

                                        Generation of npfrLexA strain

                                        -

                                        We employed CRISPR-HDR (Kondo and Ueda, - 2013; Ren et al., 2013) to generate the npfrLexA mutant with the LexA knockin. We chose the - upstream and a downstream guide RNAs targeting the third exon using the CRISPR Optimal - Target Finder.

                                        -

                                        We annealed the following - upstream and downstream primer dimers, which we cloned into the BbsI site of pU6-BbsI-ChiRNA - (Addgene #45946).

                                        -
                                          -
                                        • -

                                          npfr_up_ChiRNA_F: 5’ CTTC - GCAGATGGGGAGCATCTGAG 3’

                                          -
                                          • -
                                        • -

                                          npfr_up_ChiRNA_R: 5’ AAAC - CTCAGATGCTCCCCATCTGC 3’

                                          -
                                          • -
                                        • -

                                          npfr_down_ChiRNA_F: 5’ CTTC - ATTGCGAGCAGTGCGCATGA 3’

                                          -
                                          • -
                                        • -

                                          npfr_down_ChiRNA_R: 5’ AAAC - TCATGCGCACTGCTCGCAAT 3’

                                          -
                                          • -
                                        -

                                        We amplified the npfr upstream (1426 bp, nucleotides 3 - R:6190969 to 6192394, release = r 6.16) and downstream (1250 bp, nucleotides 3 R:6192051 to - 6193300, release = r 6.16) homology arms using the following primers:

                                        -
                                          -
                                        • -

                                          npfr_LA_KpnI_F: 5’ - GACGCATACCAAACGGTACC TGTGCTGCATAAATTACGGCGACGG 3’

                                          -
                                          • -
                                        • -

                                          npfr_LA_KpnI_R: 5’ - TTTTGATTGCTAGCGGTACC AGATGCTCCCCATCTGCCAGCTGGG 3’

                                          -
                                          • -
                                        • -

                                          npfr_RA_NdeI_F: 5’ CTAGGCGCGCCCATATG - TGCGCACTGCTCGCAATCTGTTCAT 3’

                                          -
                                          • -
                                        • -

                                          npfr_RA_NdeI_R: 5’ GACAAGCCGAACATATG - CGCGCCCACGAACTGCAGGC 3’

                                          -
                                          • -
                                        -

                                        We used the In-Fusion cloning kit - (Clontech) to clone the upstream and downstream homology arms into the KpnI and NdeI sites - of pBPLexA::p65Uw (Addgene - #26231).

                                        -

                                        The pU6-BbsI-ChiRNA-npf_up, and - pU6-BbsI-ChiRNA-npf_down, - pBPLexA::p65Uw-npf_LA + RA - plasmids were co-injected into the BDSC #55821 strain (BestGene Plan R), which provided the - source of Cas9.

                                        -

                                        We used the following primers to - genotype the transformants (as shown in Figure 7—figure supplement 1):

                                        -
                                          -
                                        • -

                                          npfr[LexA]LA_GT_F (P1): 5’ - CATGTCTCGCCTTGATGTGCTGC 3’

                                          -
                                          • -
                                        • -

                                          npfr[LexA]LA_GT_R (P2): 5’ - AAAGCCCAGTCGCTGTGCTATCT 3’

                                          -
                                          • -
                                        • -

                                          npfr[LexA]RA_GT_F (P3): 5’ - TCAAATACCCTTGGATCGAAGTAAA 3’

                                          -
                                          • -
                                        • -

                                          npfr[LexA]RA_GT_R (P4): 5’ - CACAGCGAGAAGATCGAGTAGTAGAA 3’

                                          -
                                          • -
                                        -

                                        The following primers were used - to amplify npfr cDNA, - which we obtained by performing RT-PCR using mRNA extracted from npfrLexA and control flies:

                                        -
                                          -
                                        • -

                                          npfr_Deletion_F1 (P5): 5’ - CACCTCGGATCTGAATGAGACTGG 3’

                                          -
                                          • -
                                        • -

                                          npfr_Deletion_R1 (P6): 5’ - AGACGATTAGCACGCCGTACATG 3’

                                          -
                                          • -
                                        • -

                                          npfr_Deletion_F2 (P7): 5’ - CACCCTGGTTGTTATAGCCGTCAT 3’

                                          -
                                          • -
                                        • -

                                          npfr_Deletion_R2 (P8): 5’ - ACGCACAGCGAGAAGATCGAGTAG 3’

                                          -
                                          • -
                                        -

                                        Generation of P[g-npf+] transgenic flies

                                        -

                                        We obtained a plasmid covering - 20,306 bp of the npf - genomic region from P[acman] Resources (http://www.pacmanfly.org/libraries.html). The - P[acman] BAC CH322-163E17 plasmid, and a plasmid source of phiC31 were co-injected into a strain - (BDSC #9723) with an attP40 site (BestGene Plan H).

                                        -

                                        - Immunohistochemistry

                                        -

                                        Fly brains were dissected in - ice-cold phosphate-buffered saline (PBS, pH 7.4, diluted from a sterile filtered 10x PBS - stock, cat#:119-069-131, Quality Biological, Inc. 1x working concentration contains 137 mM - NaCl, 2.7 mM KCl, 2 mM KH2PO4, 8 mM Na2HPO4) and fixed in 4 % paraformaldehyde in - PBST (0.3 % Triton X-100 in PBS) at room temperature for ~ 20 min. Brains were washed three - times in PBST for 20 min each time, and blocked in 5 % normal goat serum in PBST for 1 hr. - The brains were incubated with primary antibodies diluted in 5 % normal goat serum in PBST - for 24 hr at 4 °C. Samples were washed three times with PBST before applying secondary - antibodies for 3 hr at 25 °C in darkness. After washing three times with PBST, the samples - were mounted with VectaShield (Vector Labs) on glass slides. The primary antibodies were - chicken anti-GFP (1:1000, Invitrogen, A-10262), rabbit anti-DsRed (1:1000, Clontech, - 632496), mouse nc82 (1:250, Developmental Studies Hybridoma Bank), rabbit anti-FruM - (1:10000) (Stockinger et al., 2005), rat anti-DsxM (1:500) (Hempel and Oliver, - 2007) rabbit anti-NPF (1:250 ABIN641365), and mouse anti-V5 (1:500 DyLight549 - tagged, MCA2894D549GA BioRad). The secondary antibodies were AlexaFluor 488 goat - anti-chicken (1:1000; Invitrogen, A-11039), AlexaFluor 488 goat anti-rat (1:1000; - Invitrogen, A-11006), AlexaFluor 568 goat anti-rabbit (1:1000; Invitrogen, A-11011), - AlexaFluor 633 goat anti-mouse (1:1000; Invitrogen, A-21050), Rhodamine Red-X goat anti - rabbit IgG (1:1000; Molecular Probe, R6394). We adapted a previously described method for - anti-V5 and anti-GFP double staining (Nern et al., 2015). - Briefly, we first used chicken anti-GFP as the primary antibodies (1:1000, Invitrogen, - A-10262) for 24 hr 4 °C. We washed the brains three times with PBST, and then added - AlexaFluor 488 goat anti-chicken IgG (1:1000; Invitrogen, A-11039) and DyLight549 tagged - mouse anti-V5 antibodies (1:500 DyLight549 tagged, MCA2894D549GA BioRad). The brains were - incubated at 25 °C for 3 hr in darkness, washed three times in PBST, and mounted with - VectaShield (Vector Labs) on glass slides. We performed the imaging using a Zeiss LSM 700 - confocal microscope, and processed the images using ImageJ.

                                        -

                                        GRASP analysis -

                                        -

                                        To detect native GRASP GFP - fluorescence in brains, we used flies aged for ~ 20 days to enhance the reconstructed GFP - signals. We dissected the brains in ice-cold PBS, fixed the tissue for 20 min in 4 % - paraformaldehyde in PBST at 25 °C, washed three times with PBST, and mounted the brains in - PBS for imaging the native fluorescent signals.

                                        -

                                        Ex vivo - Ca2+ imaging

                                        -

                                        We dissected brains from 7 to 15 - day-old males (separated from females for 5 days, raised in ~ 10 male-only group) in cold - Drosophila imaging saline - (108 mM NaCl, 5 mM KCl, 2 mM CaCl2, 8.2 mM MgCl2, 4 mM NaHCO3, 1 mM NaH2PO45 mM trehalose, 10 mM sucrose, 5 mM - HEPES, pH = 7.5 (Inagaki et al., 2014), transferred individual brains to 35 mm - plastic Petri dishes (35 3001 Falcon), attached the brain down to the bottom of the dish - with a slice harp (SHD-26GH/10, Warner Instruments), and bathed each brain in 2 ml Drosophila imaging saline. - We imaged the Ca2+ - dynamics using a Zeiss LSM 700 confocal microscope. The images were acquired using a Zeiss - 20x water objective (20x/1.0 DIC (uv) VIS-IR, Zeiss) and a 488 nm laser, with the anterior - side of the brain facing up to the objective. The images were acquired at a 128 × 128 pixel - resolution, and at a frame rate of ~ 10 Hz.~ 10 Z axial sections were imaged in one - time-series cycle. The section interval was ~ 1 μm. The time intervals between each cycle - were 2 s.

                                        -

                                        Before stimulating a brain, we - imaged the basal GCaMP3 signals for ≥ 10 cycles. We then gently added 200 μl 50 mM ATP (pH - adjusted to 7.0, Sigma, A2383-5G) into the Drosophila imaging saline, resulting in a - final ATP concentration of 5 mM. We performed a stack registration using the ImageJ Plugins - registration module and measured the GCaMP3 intensities using the ImageJ Analyze ROI manager - module. ΔF/F0 (%) was - calculated as ΔF/F0 - (%)=(F-F0)/F0 × 100. Fmax is the maximum - fluorescence value following ATP delivery. Fmin is the minimum fluorescence value - that occurred during a total of 80 time series cycles after ATP delivery. F0 is the GCaMP3 baseline value averaged - for 10 time-series cycles immediately before ATP application.

                                        -

                                        - Statistical analyses

                                        -

                                        No statistical methods were - employed to predetermine sample sizes. Sample sizes were chosen based on previous - publications (Demir and Dickson, 2005; Manoli et al., 2005; - Stockinger et - al., 2005; Pan et al., 2012; Asahina et al., 2014; - Clowney et al., - 2015; Huang et al., 2016; Zhang et al., 2016). - Statistical analysis was performed with Prism5 (GraphPad Software). We performed - nonparametric Mann-Whitney test when comparing two groups of data. For comparison of - multiple groups of data, we performed Kruskal-Wallis test followed by Dunn’s post hoc test. * indicates p - < 0.05, ** indicates p < 0.01, *** indicates p < 0.001. We present the exact number - of samples and P values in - the figure legends and in the supporting source data files. We present raw data using - scatter plots and include exact values in the source data files. When n < 10, individual - data points were identified.

                                        -

                                        Replication

                                        -

                                        We used only biological - replicates throughout this work. To perform the behavioral studies, we defined biological - replicates as animals of the same genotype and rearing conditions, exposed to identical - treatments. Courtship indexes were calculated using n = 6—27 individual animals. Preference - indexes were calculated using n = 12 individual animals. Chaining indexes were calculated - using n = 6 groups (8—12 individual animals in each group). Lunging numbers were calculated - using n = 10—12 animals. All animals were used once, since their behavioral indexes are - sensitive to prior experience. Replicates for the Ca2+ imaging were defined as the number - of neurons (Figure 6C - and F) or the selected regions (Figure 8E) analyzed per genotype and - condition. In all cases we used 3—9 brains/genotype and condition. 2—5 neurons (Figure 6C and F) or - 4—7 regions of selection (Figure 8E) were used per brain. Replicates for - the immunostaining were defined as brains of the same genotype that underwent identical - staining procedures. We stained ≥ 5 brains per experiment. The Gal4/UAS (or LexA/LexAop) binary systems are highly - reproducible. Images that were the most intact were selected for display. We did not exclude - any data points.

                                        -

                                        Group - allocation

                                        -

                                        To perform the behavioral assays, - the control and experimental groups were reared under the same conditions, collected on the - same day, aged in parallel, and assayed on the same day. The control and experimental groups - were assayed in an arbitrary order. Behavioral videos were randomly permuted for scoring - behavioral indexes. All behavioral analyses were obtained from videos, in which the - genotypes were masked. The indexes were calculated blindly.

                                        -

                                        To perform the Ca2+ imaging, the control - and experimental groups were assayed in an arbitrary order. The raw Ca2+ imaging data files were permutated - in order and analyzed by Image J software.

                                        -

                                        Source data - files

                                        -

                                        The raw data for the behavioral - assays, Ca2+ imaging - assays, summary statistics, and full stacks of the entire brains used in the GRASP - experiments are included in the source data files.

                                        -
                                        -

                                        References

                                        -
                                          -
                                        1. -
                                          - -
                                          - -
                                          -
                                          The continuing case for the Renshaw cell - -
                                            - - -
                                          - -
                                          2. -
                                        2. -
                                          - -
                                          - -
                                          -
                                          Tachykinin-expressing neurons control male-specific - aggressive arousal in Drosophila - -
                                            - - - - - - - - -
                                          - -
                                          3. -
                                        3. -
                                          - -
                                          - -
                                          -
                                          Altered electrical properties in Drosophila neurons - developing without synaptic transmission - -
                                            - - - - - -
                                          - -
                                          4. -
                                        4. -
                                          - -
                                          - -
                                          -
                                          FlyMAD: rapid thermogenetic control of neuronal activity - in freely walking Drosophila - -
                                            - - - - - - -
                                          - -
                                          5. -
                                        5. -
                                          - -
                                          - -
                                          -
                                          Targeted gene expression as a means of altering cell - fates and generating dominant phenotypes - -
                                            - - -
                                          - -
                                          6. -
                                        6. -
                                          - -
                                          - -
                                          -
                                          Identification of a Drosophila brain-gut peptide related - to the neuropeptide Y family - -
                                            - - - - - - -
                                          - -
                                          7. -
                                        7. -
                                          - -
                                          - -
                                          -
                                          - - Drosophila doublesex gene controls somatic sexual differentiation by producing - alternatively spliced mRNAs encoding related sex-specific polypeptides - -
                                            - - -
                                          - -
                                          8. -
                                        8. -
                                          - -
                                          - -
                                          -
                                          - - The interstitial nuclei of the human anterior hypothalamus: an investigation of sexual - variation in volume and cell size, number and density - -
                                            - - - - - - - - -
                                          - -
                                          9. -
                                        9. -
                                          - -
                                          - -
                                          -
                                          Multimodal chemosensory circuits controlling male - courtship in Drosophila - -
                                            - - - - - -
                                          - -
                                          10. -
                                        10. -
                                          - -
                                          - -
                                          -
                                          - - A second function of gamma frequency oscillations: an E%-max winner-take-all mechanism - selects which cells fire - -
                                            - - - -
                                          - -
                                          11. -
                                        11. -
                                          - -
                                          - -
                                          -
                                          fruitless splicing specifies male courtship behavior in - Drosophila - -
                                            - - -
                                          - -
                                          12. -
                                        12. -
                                          - -
                                          - -
                                          -
                                          Wired for sex: the neurobiology of Drosophila mating - decisions - -
                                            - -
                                          - -
                                          13. -
                                        13. -
                                          - -
                                          - -
                                          -
                                          Serotonin and neuropeptide F have opposite modulatory - effects on fly aggression - -
                                            - - -
                                          - -
                                          14. -
                                        14. -
                                          - -
                                          - -
                                          -
                                          - - GFP reconstitution across synaptic partners (GRASP) defines cell contacts and synapses - in living nervous systems - -
                                            - - - - - - - -
                                          - -
                                          15. -
                                        15. -
                                          - -
                                          - -
                                          -
                                          A transcriptional reporter of intracellular Ca2+ in - Drosophila - -
                                            - - - - - - -
                                          - -
                                          16. -
                                        16. -
                                          - -
                                          - -
                                          -
                                          A sex difference in the hypothalamic uncinate nucleus: - relationship to gender identity - -
                                            - - -
                                          - -
                                          17. -
                                        17. -
                                          - -
                                          - -
                                          -
                                          Characterization of a functional neuropeptide F receptor - from Drosophila melanogaster - -
                                            - - - - - -
                                          - -
                                          18. -
                                        18. -
                                          - -
                                          - -
                                          -
                                          Motor control in a Drosophila taste circuit - -
                                            - - -
                                          - -
                                          19. -
                                        19. -
                                          - -
                                          - -
                                          -
                                          Temperature-sensitive mutations in Drosophila - melanogaster. XIV. A selection of immobile adults - -
                                            - - - - -
                                          - -
                                          20. -
                                        20. +
                                        +
                                          +
                                          +

                                          To address if the projections of NPF + and P1 neurons form direct connections, we used the R71G01-Gal4 (which is expressed in P1 neurons + and a few other neurons) to drive expression of spGFP1-10, and npfLexA to drive expression of + spGFP11. We detected strong GFP signals reconstructing the LPC structure in the male brain (Figure 5G), but not in + the corresponding brain regions of female brains or control male brains that do not have the + driver for LexAop-spGFP11 (Figure 5H and I). The + GRASP GFP signals appear to be due to expression of the two parts of the split GFP in NPFM and P1 neurons for the + following reasons. First, NPFM and P1 neurons are both male-specific, + and the GRASP signals are primarily in the male brain and not in the female brain (Figure 5G and H). + Second, the GRASP signals label two LPC structures: the lateral junction and SMPr arch (Figure 5G). Third, the + projections of NPFM and + P1 overlap extensively in the lateral junction and SMPr arch (Figure 5D—F and Video 2), while fru- NPF projections do not innervate + the LPC region (Figure 3F + and G and Video + 1). Thus, the GRASP signals in the LPC structure appear to be formed by connections + between NPFM and P1 + neurons.

                                          +

                                          To clarify the directionality of the + synaptic connections between NPFM and P1 neurons, we employed genetically + encoded markers to label the dendritic (UAS-DenMark) and axonal (UAS-syt::eGFP) branches of NPF and P1 neurons + (Wang et al., + 2007; Nicolaï et al., 2010). The P1 neurons that extend processes to the + lateral junction and SMPr arch within the LPC structure were stained with both Denmark and + Syt::eGFP, suggesting that P1 neurons send and receive signals within these neuropils (Figure 5—figure supplement + 3A, a1-a6). However, in the corresponding lateral junction and SMPr arch within the LPC + region, NPF neurons were labeled with DenMark only (Figure 5—figure supplement 3B, b1-b3), suggesting + that NPF neurons mainly receive signals within this region. The NPF axons that stained with + Syt::eGFP occurred in several brain regions other than the LPC region (Figure 5—figure supplement + 3B, b1-b6).

                                          +

                                          To distinguish the boutons formed by + NPFM neurons from other + NPF neurons, we used the FlpOut approach to specifically label projections of NPFM neurons. We stained the + brains of male UAS > stop + > mCD8::GFP/+;fruFLP/npf-Gal4 flies (Yu et al., 2010) with + anti-GFP and anti-NPF so that the boutons formed by NPFM neurons would be double labeled. We + found that the double-labeled boutons were concentrated in the medial anterior brain, but not in + the lateral superior brain (Figure 5—figure supplement 3C, c1-c6), indicating + that the release site of NPFM neurons was outside the LPC region. + These results demonstrate that NPFM neurons do not directly act on P1 + neurons. Rather, the synaptic connections between NPFM and P1 neurons in the LPC region are + formed by pre-synaptic P1 neurons and post-synaptic NPFM neurons.

                                          +

                                          To determine the impact of activation + of P1 neurons on the activity of the NPFM neurons, we combined chemogenetics and + GCaMP imaging to monitor Ca2+ dynamics (Yao et al., 2012) as an + indicator of neural activation. We expressed P2X2 (encoding an ATP-gated cation channel) + (Lima and + Miesenböck, 2005) in P1 neurons, and expressed GCaMP3 in NPF neurons. We used R71G01-LexA, which is expressed + in P1 neurons and a few other neurons, to drive P2X2 expression, and npf-Gal4 to drive UAS-GCaMP3. In a complementary experiment, we + switched the two binary systems, and used the R71G01-Gal4 and npfLexA to drive P2X2 and GCaMP3, respectively. Because the diffusion + rate and final concentration of ATP that reaches the brain varies across samples, we calculated + the maximum fold changes of the GCaMP3 responses after ATP application relative to the basal + levels of GCaMP3 before ATP application. We found that ATP-induced activation of P1 neurons led + to robust GCaMP3 signals in NPFM neurons (Figure 6A—C and Figure 6—figure supplement 1 and Videos 3 and 4).

                                          +
                                            +
                                          1. +
                                            + +
                                            +

                                            + Neural activity changes in NPFM neurons in response to + activation of P1 neurons.

                                            +

                                            (A—C) UAS-GCaMP3, LexAop- P2X2/R71G01-LexA;npf-Gal4/+ male brains + were imaged for GCaMP3 responses. Cell bodies of NPFM neurons were imaged. (A) Representative heat + maps indicating GCaMP3 fluorescence before and during ATP application. The numbers + indicate NPFM + neurons. (B) + Representative traces showing dynamic changes in GCaMP3 fluorescence in NPFM neurons (circled + in panel A). + (C) Largest + GCaMP3 fluorescence changes [(Fmax-F0)/ F0 (%)] in response to ATP + application in the control and experimental group. GCaMP3 fluorescence was recorded from + 12 NPFM neurons + from eight control brains, and 15 NPFM neurons from nine experimental + brains. (D—F) + UAS- P2X2 , LexAop-GCaMP3/R15A01-AD; npfLexA / R 71 G01-DBD male brains + were imaged for GCaMP3 responses. The cell bodies of NPFM neurons were imaged. (D) Representative heat + maps indicating GCaMP3 fluorescence before and during ATP application. The numbers + indicate NPFM + neurons. (E) + Representative traces showing dynamic changes in GCaMP3 fluorescence in NPFM neurons (circled + in panel D). + (F) Largest + GCaMP3 fluorescence changes [(Fmax-F0)/ F0 (%)] in response to ATP + application in the control and experimental group. GCaMP3 fluorescence was recorded from + 10 NPFM neurons + from three control brains, and 12 NPFM neurons from three experimental + brains. The scale bars in (A and D) represent 10 μm. The bars in + (C and F) indicate means ± + SEMs. Significance was assessed using the Mann Whitney test, ***p < 0.001.

                                            +

                                            10.7554/eLife.49574.037Figure + 6—source data 1.

                                            +

                                            Figure + 6C Source data.

                                            +
                                            @@ -3719,28 +1677,15 @@

                                            References

                                            content="https://via.placeholder.com/600x60/dbdbdb/4a4a4a.png?text=Unknown" src="https://via.placeholder.com/600x60/dbdbdb/4a4a4a.png?text=Unknown">
                                            -
                                            - - Investigating the function of follicular subpopulations during Drosophila oogenesis - through hormone-dependent enhancer-targeted cell ablation - -
                                              - - - -
                                            - -
                                            2. -
                                          2. + +
                                              + +

                                              10.7554/eLife.49574.038Figure + 6—source data 2.

                                              +

                                              Figure 6C Summary statistics.

                                              +
                                              @@ -3748,22 +1693,15 @@

                                              References

                                              content="https://via.placeholder.com/600x60/dbdbdb/4a4a4a.png?text=Unknown" src="https://via.placeholder.com/600x60/dbdbdb/4a4a4a.png?text=Unknown">
                                              -
                                              Sex-specific DoublesexM expression in subsets of - Drosophila somatic gonad cells - -
                                                - - -
                                              - -
                                              1. -
                                            1. + +
                                                + +

                                                10.7554/eLife.49574.039Figure + 6—source data 3.

                                                +

                                                Figure 6F Source + data.

                                                +
                                                @@ -3771,31 +1709,15 @@

                                                References

                                                content="https://via.placeholder.com/600x60/dbdbdb/4a4a4a.png?text=Unknown" src="https://via.placeholder.com/600x60/dbdbdb/4a4a4a.png?text=Unknown">
                                                -
                                                P1 interneurons promote a persistent internal state that - enhances inter-male aggression in Drosophila - -
                                                  - - - - - -
                                                - -
                                                1. -
                                              1. + +
                                                  + +

                                                  10.7554/eLife.49574.040Figure + 6—source data 4.

                                                  +

                                                  Figure 6F Summary statistics.

                                                  +
                                                  @@ -3803,22 +1725,167 @@

                                                  References

                                                  content="https://via.placeholder.com/600x60/dbdbdb/4a4a4a.png?text=Unknown" src="https://via.placeholder.com/600x60/dbdbdb/4a4a4a.png?text=Unknown">
                                                  -
                                                  Courtship in Drosophila mosaics: sex-specific foci for - sequential action patterns - -
                                                    - - -
                                                  - -
                                                  1. -
                                                1. + +
                                                    + + + +
                                                    1. +
                                                  1. +
                                                    +
                                                    +

                                                    Ca2+ imaging of + NPFM neurons in + response to activation of P1 neurons.

                                                    +

                                                    (A) UAS- P2X2,LexAopGCaMP3/+;R71G01-Gal4,npfLexA/+ male brains were + imaged for GCaMP3 responses upon ATP application. Heat maps show the basal and maximal + GCaMP3 fluorescence levels before and during ATP application. The numbers indicate + NPFM neurons. The + scale bar represents 10 μm. (B) Representative traces of dynamic + GCaMP3 fluorescence changes in the NPFM neurons indicated in (A).

                                                    +
                                                    +
                                                    +
                                                    2. +
                                                  +
                                                  +
                                                  + +
                                                  + +
                                                  +
                                                  +
                                                    +
                                                    +
                                                    +
                                                    + +
                                                    + +
                                                    +
                                                    +
                                                      +
                                                      +

                                                      In order to exclude the impact from + other neurons, we expressed P2X2 in P1 neurons only using a split-P1-Gal4 comprised of R15A01-AD (activation domain) + and R71G01-DBD (DNA-binding + domain). We imaged Ca2+ + dynamics in NPFM neurons + in response to ATP application, and detected large increases in GCaMP3 fluorescence in response + to activation of P1 neurons (Figure 6D—F), further supporting the conclusion + that P1 neurons directly activate NPFM neurons.

                                                      +

                                                      Increase + in courtship by inhibiting NPFM neurons depends indirectly on P1 + neurons

                                                      +

                                                      To determine whether the function of + NPFM neurons in courtship + regulation is dependent on P1 neurons, we tested if silencing P1 neurons would prevent the + courtship elevation induced by disruption of NPF neurons. We expressed UAS-Shits in both NPF and P1 neurons (npf-Gal4 and R71G01-Gal4) and assayed male courtship at + both permissive and non-permissive temperatures. We found that the courtship dis-inhibition + caused by disrupting NPF neurons was eliminated by simultaneous disruption of P1 neurons (Figure 7A—C). The + results suggest that NPFM + neurons appear to act through P1 neurons to regulate male courtship. Alternatively, NPFM and P1 neurons may act in + parallel and serve opposing inputs onto a common neuronal target.

                                                      +
                                                        +
                                                      1. +
                                                        + +
                                                        +

                                                        + Effects of inactivating NPF and P1 neurons on male courtship, characterization of npfr reporter + expression, and impact of npfr on male courtship.

                                                        +

                                                        (A—C) Effects of silencing both NPF + and P1 neurons with Shits (npf-Gal4/+;R71G01-Gal4/UAS-Shits) on courtship of + group-housed males towards female targets. Male-female (M–F) courtship was assayed at + the permissive (23°C) and non-permissive (31°C) temperatures for Shits. (A) The percentages of males that + initiated courtship. n = 4 (6 flies/group). (B) The courtship indexes were + scored based on 20—30 min of observation during a 30 min incubation period. n = 24. + (C) Effect of + silencing both NPF and P1 neurons with Shits (npf-Gal4/+;R71G01-Gal4/UAS-Shits) on male-male (M–M) + courtship. Isolation-housed males were assayed for chaining behavior at 23°C and 31°C + for 10 min. n = 6 (8—12 flies/group). The bars indicate means ± SEMs. Significance was + assessed using the Mann-Whitney test. *p < 0.05, **p < 0.01, ***p < 0.001. + (D—F) Spatial + distribution of npfr + (mCherry) and P1 (GFP) + reporters in a male brain (UAS-mCD8::GFP/+;R71G01-Gal4/npfrLexA,LexAop-mCherry). The reporters were + detected with GFP and DsRed antibodies. The boxed regions indicate the LPC. The scale + bar represents 50 μm. (G) npfrLexA homozygous and npfrLexA/npfrc01896 trans-heterozygous + mutants were assayed for M–M courtship. The control flies are w1118-CS. n = 12—24. + (H) Effects on + M–M courtship due to knock down of npfr pan-neuronally (elav-Gal4) or in P1 neurons. n = + 21—23. The bars indicate means ± SEMs. To determine significance, we used the + Kruskal-Wallis test followed by the Dunn’s post hoc test. **p < 0.01, ***p + < 0.001.

                                                        +

                                                        10.7554/eLife.49574.045Figure + 7—source data 1.

                                                        +

                                                        Figure + 7A Source data.

                                                        +
                                                        @@ -3826,31 +1893,15 @@

                                                        References

                                                        content="https://via.placeholder.com/600x60/dbdbdb/4a4a4a.png?text=Unknown" src="https://via.placeholder.com/600x60/dbdbdb/4a4a4a.png?text=Unknown">
                                                        -
                                                        Neuromodulation of courtship drive through - tyramine-responsive neurons in the Drosophila brain - -
                                                          - - - - - -
                                                        - -
                                                        2. -
                                                      2. + +
                                                          + +

                                                          10.7554/eLife.49574.046Figure + 7—source data 2.

                                                          +

                                                          Figure 7A Summary statistics.

                                                          +
                                                          @@ -3858,43 +1909,15 @@

                                                          References

                                                          content="https://via.placeholder.com/600x60/dbdbdb/4a4a4a.png?text=Unknown" src="https://via.placeholder.com/600x60/dbdbdb/4a4a4a.png?text=Unknown">
                                                          -
                                                          - - Optogenetic control of Drosophila using a red-shifted channelrhodopsin reveals - experience-dependent influences on courtship - -
                                                            - - - - - - - - -
                                                          - -
                                                          1. -
                                                        1. + +
                                                            + +

                                                            10.7554/eLife.49574.047Figure + 7—source data 3.

                                                            +

                                                            Figure + 7G—H Source data.

                                                            +
                                                            @@ -3902,39 +1925,15 @@

                                                            References

                                                            content="https://via.placeholder.com/600x60/dbdbdb/4a4a4a.png?text=Unknown" src="https://via.placeholder.com/600x60/dbdbdb/4a4a4a.png?text=Unknown">
                                                            -
                                                            - - Sexual orientation in Drosophila is altered by the satori mutation in the - sex-determination gene fruitless that encodes a zinc finger protein with a BTB - domain - -
                                                              - - - - - - -
                                                            - -
                                                            1. -
                                                          1. + +
                                                              + +

                                                              10.7554/eLife.49574.048Figure + 7—source data 4.

                                                              +

                                                              Figure 7G—H Summary statistics.

                                                              +
                                                              @@ -3942,1400 +1941,3286 @@

                                                              References

                                                              content="https://via.placeholder.com/600x60/dbdbdb/4a4a4a.png?text=Unknown" src="https://via.placeholder.com/600x60/dbdbdb/4a4a4a.png?text=Unknown">
                                                              -
                                                              Excitation and inhibition onto central courtship neurons - biases Drosophila mate choice - -
                                                                - - - -
                                                              - -
                                                              1. -
                                                            1. -
                                                              - -
                                                              - -
                                                              -
                                                              - - A PDF/NPF neuropeptide signaling circuitry of male Drosophila melanogaster controls - rival-induced prolonged mating - -
                                                                - - - -
                                                              - -
                                                              2. -
                                                            2. -
                                                              - -
                                                              - -
                                                              -
                                                              Fruitless and doublesex coordinate to generate - male-specific neurons that can initiate courtship - -
                                                                - - - - - -
                                                              - -
                                                              3. -
                                                            3. -
                                                              - -
                                                              - -
                                                              -
                                                              - - Conditional modification of behavior in Drosophila by targeted expression of a - temperature-sensitive shibire allele in defined neurons - -
                                                                - -
                                                              - -
                                                              4. -
                                                            4. -
                                                              - -
                                                              - -
                                                              -
                                                              Female contact activates male-specific interneurons that - trigger stereotypic courtship behavior in Drosophila - -
                                                                - - - -
                                                              - -
                                                              5. -
                                                            5. -
                                                              - -
                                                              - -
                                                              -
                                                              - - Visually induced initiation of Drosophila innate courtship-like following pursuit is - mediated by central excitatory state - -
                                                                - - -
                                                              - -
                                                              6. -
                                                            6. -
                                                              - -
                                                              - -
                                                              -
                                                              Highly improved gene targeting by germline-specific Cas9 - expression in Drosophila - -
                                                                - - -
                                                              - -
                                                              7. -
                                                            7. -
                                                              - -
                                                              - -
                                                              -
                                                              Aggression in Drosophila - -
                                                                - - -
                                                              - -
                                                              8. -
                                                            8. -
                                                              - -
                                                              - -
                                                              -
                                                              - - Two distinct pools of synaptic vesicles in single presynaptic boutons in a - temperature-sensitive Drosophila mutant, shibire - -
                                                                - - -
                                                              - -
                                                              9. -
                                                            9. -
                                                              - -
                                                              - -
                                                              -
                                                              - - Spatial, temporal, and sexually dimorphic expression patterns of the fruitless gene in - the Drosophila central nervous system - -
                                                                - - - - - - -
                                                              - -
                                                              10. -
                                                            10. -
                                                              - -
                                                              - -
                                                              -
                                                              Sex- and clock-controlled expression of the neuropeptide - F gene in Drosophila - -
                                                                - - - -
                                                              - -
                                                              11. -
                                                            11. -
                                                              - -
                                                              - -
                                                              -
                                                              A difference in hypothalamic structure between - heterosexual and homosexual men - -
                                                                - -
                                                              - -
                                                              12. -
                                                            12. -
                                                              - -
                                                              - -
                                                              -
                                                              Remote control of behavior through genetically targeted - photostimulation of neurons - -
                                                                - - -
                                                              - -
                                                              13. -
                                                            13. -
                                                              - -
                                                              - -
                                                              -
                                                              Social regulation of aggression by pheromonal activation - of Or65a olfactory neurons in Drosophila - -
                                                                - - - - - - - -
                                                              - -
                                                              14. -
                                                            14. -
                                                              - -
                                                              - -
                                                              -
                                                              Male-specific fruitless specifies the neural substrates - of Drosophila courtship behaviour - -
                                                                - - - - - - -
                                                              - -
                                                              15. -
                                                            15. -
                                                              - -
                                                              - -
                                                              -
                                                              - - A comparative review of short and long neuropeptide F signaling in invertebrates: any - similarities to vertebrate neuropeptide Y signaling? - -
                                                                - - -
                                                              - -
                                                              16. -
                                                            16. -
                                                              - -
                                                              - -
                                                              -
                                                              - - Optimized tools for multicolor stochastic labeling reveal diverse stereotyped cell - arrangements in the fly visual system - -
                                                                - - - -
                                                              - -
                                                              17. -
                                                            17. -
                                                              - -
                                                              - -
                                                              -
                                                              Genetically encoded dendritic marker sheds light on - neuronal connectivity in Drosophila - -
                                                                - - - - - - - - - -
                                                              - -
                                                              18. -
                                                            18. -
                                                              - -
                                                              - -
                                                              -
                                                              - - Electrical hyperexcitation of lateral ventral pacemaker neurons desynchronizes - downstream circadian oscillators in the fly circadian circuit and induces multiple - behavioral periods - -
                                                                - - - - - - - - -
                                                              - -
                                                              19. -
                                                            19. -
                                                              - -
                                                              - -
                                                              -
                                                              Joint control of Drosophila male courtship behavior by - motion cues and activation of male-specific P1 neurons - -
                                                                - - - -
                                                              - -
                                                              20. -
                                                            20. -
                                                              - -
                                                              - -
                                                              -
                                                              Feedback inhibition enables θ-nested γ oscillations and - grid firing fields - -
                                                                - - - - -
                                                              - -
                                                              21. -
                                                            21. -
                                                              - -
                                                              - -
                                                              -
                                                              Courtship behavior in Drosophila melanogaster: towards a - 'courtship connectome' - -
                                                                - - -
                                                              - -
                                                              22. -
                                                            22. -
                                                              - -
                                                              - -
                                                              -
                                                              - - Reversible alteration in the neuromuscular junctions of Drosophila melanogaster - bearing a temperature-sensitive mutation, shibire - -
                                                                - - -
                                                              - -
                                                              23. -
                                                            23. -
                                                              - -
                                                              - -
                                                              -
                                                              Routing of spike series by dynamic circuits in the - hippocampus - -
                                                                - - -
                                                              - -
                                                              24. -
                                                            24. -
                                                              - -
                                                              - -
                                                              -
                                                              Optimized gene editing technology for Drosophila - melanogaster using germ line-specific Cas9 - -
                                                                - - - - - - - - - - - - - - - - - -
                                                              - -
                                                              25. -
                                                            25. -
                                                              - -
                                                              - -
                                                              -
                                                              Control of sexual differentiation and behavior by the - doublesex gene in Drosophila melanogaster - -
                                                                - - - - - -
                                                              - -
                                                              26. -
                                                            26. -
                                                              - -
                                                              - -
                                                              -
                                                              Sex and the single cell. II. there is a time and place - for sex - -
                                                                - - - - -
                                                              - -
                                                              27. -
                                                            27. -
                                                              - -
                                                              - -
                                                              -
                                                              Control of male sexual behavior and sexual orientation - in Drosophila by the fruitless gene - -
                                                                - - - - - - - - - -
                                                              - -
                                                              28. -
                                                            28. -
                                                              - -
                                                              - -
                                                              -
                                                              Sexual deprivation increases ethanol intake in - Drosophila - -
                                                                - - - - - -
                                                              - -
                                                              29. -
                                                            29. -
                                                              - -
                                                              - -
                                                              -
                                                              Neural circuitry that governs Drosophila male courtship - behavior - -
                                                                - - - - - -
                                                              - -
                                                              30. -
                                                            30. -
                                                              - -
                                                              - -
                                                              -
                                                              Experiments on sex recognition and the problem of sexual - selection in Drosophila - -
                                                                - -
                                                              - -
                                                              31. -
                                                            31. -
                                                              - -
                                                              - -
                                                              -
                                                              Dynamin-like protein encoded by the Drosophila shibire - gene associated with vesicular traffic - -
                                                                - - -
                                                              - -
                                                              32. -
                                                            32. -
                                                              - -
                                                              - -
                                                              -
                                                              Neurogenetics of courtship and mating in - Drosophila - -
                                                                - - -
                                                              - -
                                                              33. -
                                                            33. -
                                                              - -
                                                              - -
                                                              -
                                                              Opposite thermosensor in fruitfly and mouse - -
                                                                - - - - - - - - -
                                                              - -
                                                              34. -
                                                            34. -
                                                              - -
                                                              - -
                                                              -
                                                              Neuronal control of Drosophila courtship song - -
                                                                - - - - - - -
                                                              - -
                                                              35. -
                                                            35. -
                                                              - -
                                                              - -
                                                              -
                                                              Drosophila spichthyin inhibits BMP signaling and - regulates synaptic growth and axonal microtubules - -
                                                                - - - - - -
                                                              - -
                                                              36. -
                                                            36. -
                                                              - -
                                                              - -
                                                              -
                                                              A common genetic target for environmental and heritable - influences on aggressiveness in Drosophila - -
                                                                - - - - -
                                                              - -
                                                              37. -
                                                            37. -
                                                              - -
                                                              - -
                                                              -
                                                              - - A circuit node that integrates convergent input from neuromodulatory and social - Behavior-Promoting neurons to control aggression in Drosophila - -
                                                                - - - - - - - -
                                                              - -
                                                              38. -
                                                            38. -
                                                              - -
                                                              - -
                                                              -
                                                              Spatial representation of the glomerular map in the - Drosophila protocerebrum - -
                                                                - - - -
                                                              - -
                                                              39. -
                                                            39. -
                                                              - -
                                                              - -
                                                              -
                                                              Developmental control of foraging and social behavior by - the Drosophila neuropeptide Y-like system - -
                                                                - - - - - - -
                                                              - -
                                                              40. -
                                                            40. -
                                                              - -
                                                              - -
                                                              -
                                                              Genes and circuits of courtship behaviour in Drosophila - males - -
                                                                - - -
                                                              - -
                                                              41. -
                                                            41. -
                                                              - -
                                                              - -
                                                              -
                                                              Analysis of functional neuronal connectivity in the - Drosophila brain - -
                                                                - - - - - -
                                                              - -
                                                              42. -
                                                            42. -
                                                              - -
                                                              - -
                                                              -
                                                              Cellular organization of the neural circuit that drives - Drosophila courtship behavior - -
                                                                - - - - - -
                                                              - -
                                                              43. -
                                                            43. -
                                                              - -
                                                              - -
                                                              -
                                                              Dopaminergic circuitry underlying mating drive - -
                                                                - - - -
                                                              - -
                                                              44. -
                                                            44. -
                                                              - -
                                                              - -
                                                              -
                                                              A subset of octopaminergic neurons are important for - Drosophila aggression - -
                                                                - - - -
                                                              - -
                                                              45. -
                                                            45. -
                                                              - -
                                                              - -
                                                              -
                                                              Central neural circuitry mediating courtship song - perception in male Drosophila - -
                                                                - - - - - - -
                                                              - -
                                                              46. -
                                                            - -
                                                            2. - - - \ No newline at end of file + +
                                                              + + + + +
                                                            1. +
                                                              +
                                                              +

                                                              npfrLexA mutant.

                                                              +

                                                              (A) Schematic of the npfrLexA knock-in + reporter/mutant line generated by CRISPR-HDR and npfrc01896 transposable + element insertion mutant (inverted triangle indicates the transposon insertion site). + (B) Genotyping + using the indicated primers to perform PCR using genomic DNA confirmed the integration + of LexA and the mini-white cassette into + the npfr locus. The + control is w1118-CS. + (C) RT-PCR using + RNA and the indicated primers confirmed that the npfr transcripts were disrupted in + the npfrLexA mutant. RT-PCR + amplification of rp49 + from the control (w1118-CS) and + npfrLexA served as a control + for the quality of the RNA.

                                                              +
                                                              +
                                                              +
                                                              2. + +

                                                              NPF binds to a G protein-coupled + receptor—the NPF receptor (NPFR), which couples to a Gi signaling pathway to inhibit npfr-expressing neurons (Garczynski et al., + 2002). To address the roles of the npfr gene and NPFR neurons in regulating male + courtship, we replaced a portion of the npfr coding region with LexA, thereby generating an npfr mutant and a reporter (Figure 7—figure supplement 1). We + then used the R71G01-Gal4 and + npfLexA/+ to label P1 neurons and + NPFR neurons with GFP and mCherry, respectively. We found that they primarily stain distinct + neuronal populations (Figure 7D—F), indicating that P1 neurons are not + the npfr-expressing neurons. + These results further support our data suggesting that NPFM axons do not send signals directly to + P1 dendrites, but that P1 neurons signal to NPFM neurons.

                                                              +

                                                              We assayed courtship behavior of npfrLexA mutant flies, demonstrating + that these mutant animals raised in isolation exhibit significantly higher M–M courtship than + control males (Figure + 7G). We observed similar results with npfrLexA/npfrc01896 trans-heterozygous flies + (Figure 7G). + RNAi-mediated knockdown of npfr using a pan-neuronal Gal4 (elav) also increased M–M courtship behavior + (Figure 7H). In + contrast, knocking down npfr + expression in P1 neurons had no effect (Figure 7H).

                                                              +

                                                              We took advantage of the GRASP method + to investigate whether NPFR and P1 neurons make direct connections. We used R71G01-Gal4 and npfrLexA drivers to express spGFP1-10 + and spGFP11 respectively. We detected GRASP signals in the lateral crescent within the LPC + region of the male brain (Figure 8A,a1,a2). In contrast, we did not detect + GRASP GFP fluorescence in female brains or in control male brains (Figure 8B,b1,b2 and Figure 5I).

                                                              +
                                                              +
                                                              +

                                                              Anatomical and + physiological interactions between NPFR and P1 neurons.

                                                              +

                                                              (A and B) GRASP analyses to test for + close associations between npfr and P1 neurons. UAS-spGFP1-10,LexAop-spGFP11/R71G01-Gal4,npfrLexA male and female brains + were imaged for reconstituted GFP signals. (A) Reconstituted GFP signals in a male + brain. The boxes indicate the higher magnification images (a1 and a2) showing the bouton-shaped + GFP signals in the lateral crescent within the LPC. (B) Reconstituted GFP signals in a + female brain. The boxes indicate the zoomed in areas (b1 and b2) showing the lateral regions + of the female brain, corresponding approximately to the lateral crescent regions in the male + brain. The scale bars represent 50 μm in (A and B), and 10 μm in a1—a2 and b1—b2. A + portion of the brain stacks, including the LPC structure, is shown. The full brain stacks + are presented in the source data files. (C—E) Assaying effects on P1 neuronal + activity with GCaMP3, after stimulating npfr neurons with ATP. GCaMP3 and P2X2 were expressed specifically in P1 + and npfr neurons, + respectively, in the following flies: UAS-GCaMP3, LeAop P2X2/+;R71G01-Gal4/npfrLexA. GCaMP3 responses were + imaged in the LPC structures in male brains. (C) Representative heat maps indicating + GCaMP3 fluorescence before and during ATP application. The numbers indicate the regions + within the LPC structure measured. (D) Representative traces showing + dynamic fluorescence changes in the specified regions circled in (C). (E) Maximal fluorescence increases + [(Fmax-F0)/ F0 (%)] in response to ATP application. + GCaMP3 fluorescence was recorded from 25 regions from five control brains, and 22 regions + from four experimental brains. The scale bar in (C) represents 50 μm. The bars in + (E) indicate means ± + SEMs. To determine significance, we used the Mann Whitney test. ***p < 0.001. (F) A model illustrating + the feedback loop of NPFM neurons in the regulation of P1 + neuronal activity. (G) Illustration of a feedforward + parallel model, in which target neurons (X neurons) receive parallel input from P1 neurons + and NPFR neurons.

                                                              +

                                                              10.7554/eLife.49574.050Figure + 8—source data 1.

                                                              +

                                                              Figure + 8E Source data.

                                                              +
                                                              +
                                                              + +
                                                              + +
                                                              +
                                                              +
                                                                +
                                                                +

                                                                10.7554/eLife.49574.051Figure + 8—source data 2.

                                                                +

                                                                + Figure + 8E Summary statistics.

                                                                +
                                                                +
                                                                + +
                                                                + +
                                                                +
                                                                +
                                                                  +
                                                                  +

                                                                  10.7554/eLife.49574.052Figure + 8—source data 3.

                                                                  +

                                                                  Figure + 8A—B Full stacks.

                                                                  +
                                                                  +
                                                                  + +
                                                                  + +
                                                                  +
                                                                  +
                                                                    +
                                                                    +
                                                                    +
                                                                    +

                                                                    To examine whether activation of NPFR + neurons affects the activity of P1 neurons, we expressed P2X2 in NPFR neurons, and GCaMP3 in P1 neurons. We found that + activation of NPFR neurons with ATP application induced robust GCaMP3 responses in the LPC + structure (Figure 8C—E + and Video 5). In + control flies that did not express P2X2 , application of ATP did not induce + elevation of GCaMP3 fluorescence (Figure 8E). The preceding results indicate that at + least a subset of NPFR neurons anatomically connect and functionally activate P1 neurons. + Together, our results indicate that NPFM, NPFR and P1 neurons form intricate + interactions, and ensure proper courtship output in accordance with a male’s internal drive + state.

                                                                    +
                                                                    +
                                                                    + +
                                                                    + +
                                                                    +
                                                                    +
                                                                      +
                                                                      +

                                                                      Discussion

                                                                      +

                                                                      Multiple studies report the + contribution of external sensory cues in inducing or suppressing male courtship behavior by + signaling onto the P1 courtship decision center in the male brain (Kimura et al., 2008; Yu et al., + 2010; Kohatsu et al., 2011; von Philipsborn et al., + 2011; Pan et al., 2012; Bath et al., 2014; Inagaki et al., + 2014; Clowney et al., 2015; Kallman et al., 2015; + Kohatsu and + Yamamoto, 2015; Zhou et al., 2015). In contrast, much less is known about how the + P1 neurons are regulated by the male’s prior mating experience (Inagaki et al., 2014) and + how courtship is affected by the internal drive state. An exception is a recent study that + identified a group of dopaminergic neurons that changes in activity in proportion to male mating + drive, and which directly activates P1 neurons to promote male courtship (Zhang et al., 2016). In + the current study, we characterized a cluster of male-specific NPFM neurons which functions + antagonistically to dopamine neurons by serving to suppress courtship by responding to sexual + satiation. Disruption of NPFM neurons causes dis-inhibition of + courtship in satiated males. The internal drive state of males is encoded by opposing excitatory + and inhibitory inputs, which enable a male to make an appropriate mating decision in accordance + with its internal drive state.

                                                                      +

                                                                      Suppression of + NPF neurons or elimination of npf counters sexual satiation

                                                                      +

                                                                      Elimination of npf or knocking down npf expression exclusively in male-specific + NPFM neurons causes male + flies to exhibit maladaptive, hypersexual activity. In contrast to control males, which are + sexually satiated when exposed to an abundance of females, and consequently display very low + courtship levels, we found that flies overcome the sexual satiation imposed by mating if we + introduce a loss-of-function mutation in npf or inhibit NPF neurons. Thus, satiation + of courtship is dis-inhibited by disrupting NPF signaling.

                                                                      +

                                                                      Our findings that suppressing or + eliminating NPF neurons elevates male courtship is in contrast to a previous report that genetic + disruption or feminization of NPF neurons reduces male courtship activity (Lee et al., 2006). + Maintaining males in the presence or absence of females profoundly affects sexual satiation + levels, and the housing conditions were not clearly defined in this previous study. Our + conclusions are supported by multiple lines of evidence. First, we found that when we inhibit + neurotransmission from NPF neurons, using a temperature sensitive dynamin (Shits), the males showed a dramatic + increase in courtship towards female conspecifics. This occurred using group-housed males which + normally are sexually satiated. Second, introduction of a genetically encoded toxin, or + inhibition of NPF neurons by overexpression of a K+ channel, also increases courtship + activity. Third, when we disrupted the npf gene, the mutant males displayed a + remarkable increase in courtship. This effect was so profound that the males courted females of + another species and also displayed a great increase in M–M courtship, even though their gender + preferences remained unchanged. Fourth, disruption of the npfr gene resulted in significant elevation + in courtship, consistent with the effect of disrupting npf. Fifth, when we specifically silenced + male-specific fru+ NPF (NPFM) neurons, male courtship behavior was + elevated. In contrast, silencing fru- NPF neurons had no impact on male + courtship. Sixth, knocking down npf expression exclusively in NPFM neurons increased male + courtship, while knocking down npf in fru- NPF neurons had no effect.

                                                                      +

                                                                      Neuronal circuit models + entail P1 neurons activating NPFM neurons

                                                                      +

                                                                      Our anatomical, physiological and + functional evidence demonstrate that P1 neurons activate NPFM neurons, and suggest potential models + through which these neurons coordinate to regulate male courtship drive. According to one model, + P1 and NPFM neurons form + a recurrent inhibitory neuronal circuit (Figure 8F). Stimulation of P1 neurons activates + NPFM neurons, which act + through an intermediate group of NPF receptor (NPFR neurons) and feedback to inhibit P1 neurons. + This recurrent inhibitory model posits that P1 neurons are strongly activated when males are + exposed to many females, inducing NPFM neurons to release NPF. This + neuropeptide acts on the Gi-coupled NPF receptor and inhibits NPFR + neurons, leading to a suppression of P1 activity, and attenuation of male courtship. When the + activity of P1 neurons is reduced, stimulation of NPFM neurons and NPF release are diminished. + This attenuates the feedback inhibition from NPFM to P1 neurons, leading to a return of + P1 neuronal activity, and male courtship drive.

                                                                      +

                                                                      We suggest that the recurrent + inhibitory neuronal motif proposed here is important for maintaining proper activities of P1 + neurons, thus ensuring appropriate behavioral choices that are critical for a male’s + reproductive success, depending on the level of sexual satiety. Because P1 neurons integrate + multi-modal sensory input, as well as the male’s internal level of sex drive (Kohatsu et al., 2011; + Pan et al., + 2012; Bath et al., 2014; Inagaki et al., 2014; + Clowney et al., + 2015; Kallman et al., 2015; Kohatsu and Yamamoto, + 2015; Zhou et al., 2015; Zhang et al., 2016), their + activity must be under stringent control so that males display the courtship ritual only when + both external sensory cues and the internal drive states are appropriate.

                                                                      +

                                                                      The recurrent inhibitory neural motif + proposed here is dedicated to ensure appropriate activation of P1 neurons. Disruption of the + inhibitory NPF afferents leads to excessive courtship behavior in the male fly that is + maladaptive, as it overrides the courtship inhibition normally imposed by recent mating with + females, other males, or females of other Drosophila species.

                                                                      +

                                                                      Recurrent inhibitory neural motifs + are important in the central nervous system. In the mammalian spinal cord, motor neurons send + collateral branches to Renshaw cells, which in turn send inhibitory signals back to motor + neurons (Alvarez and + Fyffe, 2007). The function of this recurrent inhibition is assumed to restrict + excessive activation of motor neurons and contribute to precise recruitment of muscle fibers in + order to generate proper force for different tasks (Alvarez and Fyffe, 2007). + Recurrent inhibitory loops also occur in the hippocampus and entorhinal cortex. In these + systems, principal cells send excitatory outputs to fast-spiking, parvalbumin-positive + interneurons, and at the same time receive inhibitory inputs from these interneurons, thus, + closing the feedback inhibition loop (Pouille and Scanziani, + 2004; de Almeida et al., 2009; Pastoll et al., 2013).

                                                                      +

                                                                      While NPFM, P1 and NPFR neurons are essential for + regulating courtship by responding to prior mating experience, and may do so through a recurrent + inhibitory loop (Figure + 8F), our data do not exclude other models. Part of the argument in favor of the recurrent + inhibitory loop model is that the GRASP analysis suggests that NPFR neurons make direct + connections with P1 neurons. Moreover, by coupling chemogenetic manipulation and Ca2+ imaging, we found that + activation of NPFR neurons activate P1 neurons. However, NPFR neurons are widely distributed, + and our data do not resolve whether the NPFR neurons that activate P1 neurons are the same + subset of NPFR neurons that are the direct downstream target of NPFM neurons. Thus, one alternative to the + recurrent inhibitory motif is a feedforward parallel model, in which target neurons (X neurons) + control courtship drive by receiving parallel input from P1 neurons and NPFR neurons (Figure 8G). This latter + model posits that P1 neurons activate X neurons, and at the same time, send axonal branches to + activate NPFM neurons, + which then act through NPFR neurons and suppress the target neurons through a feedforward + mechanism. Future experiments that resolve the anatomical and functional diversity of NPFR + neurons should distinguish between the recurrent inhibitory versus feedforward parallel model, + which ensure proper courtship output in accordance with a male’s internal drive state.

                                                                      +

                                                                      Impact of NPF activity on courtship + versus aggression

                                                                      +

                                                                      Courtship and aggression are closely + interrelated social behaviors. If males are housed in isolation, they exhibit elevated courtship + and aggression (Wang + et al., 2008; Liu et al., 2011). This positive relationship is consistent with + the observation that the presence of a potential mate promotes a male fly’s propensity to fight + a competitor to win a mating competition (Kravitz and Fernandez, + 2015). Though the tendency to fight or to court is positively related, the + behavioral choice between courtship and aggression is mutually exclusive.

                                                                      +

                                                                      We found that when we disrupt the + activity of NPF neurons, M–M courtship is dominant over aggression. We suggest that loss of NPF + function diminishes inhibition of P1 neurons. As a result, even sub-optimal stimuli strongly + activate P1 neurons and induce male courtship behavior even towards inappropriate targets. + Conversely, when we increase the activity of NPF neurons or over-express the npf-cDNA in NPF neurons, M–M aggression is + dominant over courtship.

                                                                      +

                                                                      The precise contribution of NPF + neurons in regulating aggression is unresolved. One group found that activation of NPF neurons + elevates male aggression (Asahina et al., 2014) while another reported that silencing or + feminizing NPF neurons elevates aggression (Dierick and Greenspan, + 2007). We found that when we overexpressed either the Na+ channel NaChBac or the npf-cDNA in NPF neurons, the males exhibited + increased aggression. We propose that excessive NPF activity suppresses P1 neurons, thereby + setting a high threshold for P1 activation. Our observations are consistent with previous report + that weaker activation of P1 neurons favors aggression while stronger activation of P1 neurons + favors courtship (Hoopfer et al., 2015). It remains to be determined if NPF neurons + also impact on the aggression modulatory or arousal center (Asahina et al., 2014; Watanabe et al., + 2017), independent of its effect on P1 neurons.

                                                                      +

                                                                      Possible relationship + of NPF to courtship regulation by mammalian NPY

                                                                      +

                                                                      NPF is the Drosophila counterpart of mammalian NPY, + which regulates feeding, reproduction, aggression, anxiety, depression and the alcohol addiction + (Nässel and Wegener, + 2011). Previous studies indicate that sexually dimorphic NPY neurons innervate + the human INAH3 (interstitial nuclei of anterior hypothalamus 3), a region correlated with + sexual orientation and gender identity recognition (LeVay, 1991; Byne et al., + 2000; Garcia-Falgueras and Swaab, 2008). The discovery that Drosophila NPF regulates + courtship depending on the internal drive state raises questions as to whether NPY may serve + similar functions in mammals.

                                                                      +

                                                                      Materials + and methods

                                                                      +

                                                                      Key resources

                                                                      +

                                                                      Descriptions of the key fly strains, + antibodies, plasmids, chemicals, kits, services and software are provided in the Supplementary file 1. +

                                                                      +

                                                                      Fly stocks

                                                                      +

                                                                      The following strains were obtained + from Bloomington Stock Center (Indiana University): npf-Gal4 (#25681, and #25682 have identical + promoters, but are inserted on the 2nd and 3rd chromosomes, respectively), elav-Gal4 (#8765), fru-Gal4 (NP21 #30027), R71G01-Gal4 (P1-Gal4 #39599), R71G01-LexA (P1-LexA #54733), UAS-NaChBac (#9468), UAS-Kir2.1 (#6596), UAS-DTI (#25039), UAS-mCD8::GFP (#5137), UAS-npf-RNAi (VDRC108772), UAS-npfr-RNAi (VDRC107663), UAS-DenMark,UAS-syt::eGFP (#33064), LexAop-mCherry (#52271), LexAop(FRT.mCherry)ReaChR-mCitrine (#53744), UAS-IVS-mCD8::RFP, LexAop-mCD8::GFP (#32229), UAS-CD4-spGFP1-10,LexAop-CD4-spGFP11 (#58755), LexAop-IVS-CsChrimson.mVenus (#55139), Lexop(FRT.stop)myr::smGdP-V5 (#62107) npfrc01896 (#10747), tub(FRT.Gal80)stop (#38880), tub(FRT.stop)Gal80 (#38878).

                                                                      +

                                                                      UAS-npf was a gift from Dr. Ping Shen (Wu et al., + 2003) (University of Georgia), UAS- P2X2,LexAop-GCaMP3 and UAS-GCaMP3, LexAop P2X2 were from Dr. Orie Shafer (Yao et al., + 2012) (University of Michigan), UAS-Shibirets was from Dr. Christopher Potter + (Kitamoto, + 2001) (Johns Hopkins University School of Medicine), fruFLP, UAS-(FRT.stop)mCD8::GFP, UAS-(FRT.stop)Shibirets and UAS-(FRT.Shibirets)stop, UAS-(FRT.stop)dTRPA1 were from Dr. Barry Dickson (Yu et al., + 2010) (Janelia Research Campus), R71G01-DBD;R15A01-AD was from Dr. David + Anderson (California Institute of Technology).

                                                                      +

                                                                      The npfLexA and npfrLexA mutants were outcrossed into + a w1118 background for five + generations. The controls for comparison to these mutants were w1118 flies in which we exchanged + the X chromosome with Canton-S so the flies are w + on the X chromosome (w1118-CS flies). The full genotypes + of the flies used in each figure and video are listed in Supplementary file 2.

                                                                      +

                                                                      Behavioral + assays

                                                                      +

                                                                      The behavioral assays were recorded + using a Samsung SCB-3001 camera. All behavioral analyses were performed using these videos.

                                                                      +

                                                                      M–F, + and M–M courtship assays

                                                                      +

                                                                      To perform courtship assays, we added + 3 ml of 1.5 % agarose into each well of 24-well cell culture plates (Corning Incorporated, + REF353847). 2 mm diameter holes were drilled on the cover over each well. Custom silicone plugs + were prepared (435570, StockCap) for blocking the holes. The cover and the plate were taped + together to avoid gaps that might allow flies to escape.

                                                                      +

                                                                      Unless otherwise specified, 5—7 days + old mixed sex, group-housed males (10 males raised together with 30 virgin w1118 females for 3 days) were used + for the courtship assays. Three types of female targets were used: 1) mature active females, 2) + newly-eclosed females, or 3) decapitated females. In experiments in which the targets were + either grouped-housed w1118 males or Drosophila simulans females, we + used 5—7 day old isolation-housed males as the testers. One tester male and one target were ice + anesthetized, and transferred together into courtship chambers. The flies were allowed to + recover for 10 min, and then male courtship was scored over the next 10 min. The courtship index + is the fraction of time that a tester male performs courtship towards the target.

                                                                      +

                                                                      To test the effects of inhibiting npf neurons with Shits, a single tester male (npf-Gal4/+;UAS-Shits/+) and a target female (mature, + active w1118, 5—7 days old) were + ice-anesthetized, and the pair was transferred into courtship chambers. The assays were + performed at 23°C and 31°C, which are the permissive and non-permissive temperatures for Shits, respectively. Courtship + indexes were calculated based on 20—30 min observation during a 30 min incubation period.

                                                                      +

                                                                      Male + chaining assays

                                                                      +

                                                                      We inserted newly-eclosed tester + males into individual vials, and aged them for 5—7 days. We introduced 8—12 males into a 35 mm + Petri dish, which was filled with 8 ml 1.5% agarose through a 2 mm diameter hole drilled on the + cover. We allowed the flies to recover for 5 min, and then determined the ratio of time over the + next 10 min in which ≥ 3 flies engaged in simultaneous courtship (chaining index).

                                                                      +

                                                                      M–M + aggression assay

                                                                      +

                                                                      The aggression assays were carried + out as described previously (Zhou et al., 2008), using 5—7 day-old isolation-housed tester + males, and 5—7 days group-housed w1118 males as the targets. + Briefly, one tester was paired with one target in the assay. The custom-designed chambers were + based on previous reports (Zhou et al., 2008; Liu et al., 2011), and + were fabricated by the Physics Machine Shop at UCSB (Figure 1—figure supplement 3). The chamber + consists of two concentric circular chambers. The outer chamber diameter and height are 13 mm + and 7 mm, respectively. The inner chamber diameter and height are 8 mm and 3.5 mm, respectively. + The outer and inner chambers are separated by 0.5 mm thick, 3.5 mm high walls. 0.3 ml standard + corn meal and molasses fly food was added to the inner chamber. 1.5% agarose was used to fill + the space between inner and outer chambers. The heights of the food and agarose patches were the + same (3.5 mm). We then dissolved 15% sucrose and 15% yeast in apple juice, and added 15 μl + liquid to each food patch. Once the liquid mixture has soaked into the food, and the patch is + dry at the surface, the aggression chamber is ready to use. w1118 male targets were transferred + to the chamber by ice-anesthetization. A 22 × 22 mm microscope cover glass (Fisher Scientific) + was used to cover to the chamber. The targets were allowed to recover for 10 min, and the + isolation-housed tester males were introduced into the chamber by gentle tapping. After waiting + 5 min for the tester males to recover, we scored the number of lunges during the following 15 + min.

                                                                      +

                                                                      + Male and female preference assay

                                                                      +

                                                                      To test the preference of a male + tester for females versus males, we placed one decapitated w1118 virgin female and one + decapitated w1118 male in a courtship chamber. + The tester males were isolation-housed for 5—7 days since eclosion, and transferred into the + chamber by gentle tapping. After 5 min recovery time, we scored the time during which the tester + male performed courtship behavior towards either the decapitated female or the decapitated male + target over the course of 10 min. The preference index is the ratio of time that male testers + spend courting decapitated female targets out of the total courtship time.

                                                                      +

                                                                      Molecular + biology

                                                                      +

                                                                      + Generation of npf1 strain

                                                                      +

                                                                      To generate the npf1 allele (Figure 1E) we used the CRISPR + mediated NHEJ (clustered regularly interspaced short palindromic repeats – non-homologous end + joining) method (Kondo and Ueda, 2013; Ren et al., 2013).

                                                                      +

                                                                      We designed the following + oligonucleotides:

                                                                      +
                                                                        +
                                                                      • +

                                                                        npf-gRNA1-f: 5’ CTTCGCCCTTGCCCTCCTAGCCGC + 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npf-gRNA1-r: 5’ AAACGCGGCTAGGAGGGCAAGGGC + 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npf-gRNA2-f: 5’ CTTCGTTGCCATGGTCGTCTAAAA + 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npf-gRNA2-r: 5’ AAACTTTTAGACGACCATGGCAAC + 3’

                                                                        +
                                                                        • +
                                                                      +

                                                                      We annealed the oligonucleotides to + obtain two independent dimers, and ligated the primer dimers into the BbsI site of + pU6-BbsI-ChiRNA BbsI (Addgene #45946). The pU6-BbsI-npf-gDNA1 and the pU6-BbsI-npf-gDNA2 plasmids were co-injected into the + BDSC strain #51324 as the Cas9 source (BestGene Plan R). Based on DNA sequencing, we found that + npf1 harbored a single nucleotide + frameshift deletion that changed the 2nd position of codon 19.

                                                                      +

                                                                      + Generation of npfLexA strain

                                                                      +

                                                                      To generate the npfLexA line with an insertion of the + LexA reporter (Figure 1D), we used the CRISPR-HDR + (clustered regularly interspaced short palindromic repeats – homology directed repair) method + (Kondo and Ueda, + 2013; Ren et al., 2013). We chose upstream and downstream guide RNAs that + targeted the npf coding + sequences using the CRISPR Optimal Target Finder: http://tools.flycrispr.molbio.wisc.edu/targetFinder/. +

                                                                      +

                                                                      We annealed the following upstream + and downstream primer dimers, which we inserted into the BbsI site of pU6-BbsI-ChiRNA (Addgene + #45946).

                                                                      +
                                                                        +
                                                                      • +

                                                                        npf_up_ChiRNA_F: 5’ + CTTCCCAAACAATGCGTTGCATCC 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npf_up_ChiRNA_R: 5’ + AAACGGATGCAACGCATTGTTTGG 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npf_down_ChiRNA_F: 5’ + CTTCAGATTTATGTTACAGGCTCG 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npf_down_ChiRNA_R: 5’ + AAACCGAGCCTGTAACATAAATCT3’

                                                                        +
                                                                        • +
                                                                      +

                                                                      We amplified the npf upstream (1359 bp, nucleotides 3 + R:16609779 to 16611137, release = r 6.16) and downstream (1388 bp, nucleotides 3 R:16610753 to + 16612140, release = r 6.16) homology arms using the following primers:

                                                                      +
                                                                        +
                                                                      • +

                                                                        npf_LA_KpnI_F: 5’ + GACGCATACCAAACGGTACCCATTGTGACACCGTTGCGCTTTCCA 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npf_LA_KpnI_R: 5’ + TTTTGATTGCTAGCGAGTTCTATAAATGGCTAATGTATGT 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npf_RA_NdeI_F: 5’ + CTAGGCGCGCCCATATGTCGCGGTTTTAATGAGGAGGAGATATTC 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npf_RA_NdeI_R: 5’ + GACAAGCCGAACATATGATCGGACTTGGACGTGGTAAGCCAA 3’

                                                                        +
                                                                        • +
                                                                      +

                                                                      We used the In-Fusion cloning kit + (Clontech) to clone the upstream and downstream homology arms into the KpnI and NdeI sites of + pBPLexA::p65Uw (Addgene + #26231), respectively.

                                                                      +

                                                                      The pU6-BbsI-ChiRNA-npf_up, pU6-BbsI-ChiRNA-npf_down, and pBPLexA::p65Uw-npf_LA + RA plasmids were + injected into the BDSC #51323 strain, which provided the source of Cas9 (BestGene Plan R).

                                                                      +

                                                                      We used the following primers to + genotype the transformants (as shown in Figure 1—figure supplement 2A):

                                                                      +
                                                                        +
                                                                      • +

                                                                        npf[LexA]LA_GT_F (P1): 5’ + CTTTCGGCCAACATTTATTCACG 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npf[LexA]LA_GT_R (P2): 5’ + AAAGCCCAGTCGCTGTGCTATCT 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npf[LexA]RA_GT_F (P3): 5’ + TCAAATACCCTTGGATCGAAGTA 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npf[LexA]RA_GT_R (P4): 5’ + AGGGCTGCTGTAAGTATCGGTTG 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npf_Deletion_F (P5): 5’ + CTTCCCAAACAATGCGTTGCATCC 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npf_Deletion_R (P6): 5’ + AAACCGAGCCTGTAACATAAATCT 3’

                                                                        +
                                                                        • +
                                                                      +

                                                                      + Generation of npfrLexA strain

                                                                      +

                                                                      We employed CRISPR-HDR (Kondo and Ueda, + 2013; Ren et al., 2013) to generate the npfrLexA mutant with the LexA knockin. We chose the + upstream and a downstream guide RNAs targeting the third exon using the CRISPR Optimal Target + Finder.

                                                                      +

                                                                      We annealed the following upstream + and downstream primer dimers, which we cloned into the BbsI site of pU6-BbsI-ChiRNA (Addgene + #45946).

                                                                      +
                                                                        +
                                                                      • +

                                                                        npfr_up_ChiRNA_F: 5’ CTTC + GCAGATGGGGAGCATCTGAG 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npfr_up_ChiRNA_R: 5’ AAAC + CTCAGATGCTCCCCATCTGC 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npfr_down_ChiRNA_F: 5’ CTTC + ATTGCGAGCAGTGCGCATGA 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npfr_down_ChiRNA_R: 5’ AAAC + TCATGCGCACTGCTCGCAAT 3’

                                                                        +
                                                                        • +
                                                                      +

                                                                      We amplified the npfr upstream (1426 bp, nucleotides 3 + R:6190969 to 6192394, release = r 6.16) and downstream (1250 bp, nucleotides 3 R:6192051 to + 6193300, release = r 6.16) homology arms using the following primers:

                                                                      +
                                                                        +
                                                                      • +

                                                                        npfr_LA_KpnI_F: 5’ GACGCATACCAAACGGTACC + TGTGCTGCATAAATTACGGCGACGG 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npfr_LA_KpnI_R: 5’ TTTTGATTGCTAGCGGTACC + AGATGCTCCCCATCTGCCAGCTGGG 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npfr_RA_NdeI_F: 5’ CTAGGCGCGCCCATATG + TGCGCACTGCTCGCAATCTGTTCAT 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npfr_RA_NdeI_R: 5’ GACAAGCCGAACATATG + CGCGCCCACGAACTGCAGGC 3’

                                                                        +
                                                                        • +
                                                                      +

                                                                      We used the In-Fusion cloning kit + (Clontech) to clone the upstream and downstream homology arms into the KpnI and NdeI sites of + pBPLexA::p65Uw (Addgene + #26231).

                                                                      +

                                                                      The pU6-BbsI-ChiRNA-npf_up, and pU6-BbsI-ChiRNA-npf_down, pBPLexA::p65Uw-npf_LA + RA plasmids were + co-injected into the BDSC #55821 strain (BestGene Plan R), which provided the source of Cas9. +

                                                                      +

                                                                      We used the following primers to + genotype the transformants (as shown in Figure 7—figure supplement 1):

                                                                      +
                                                                        +
                                                                      • +

                                                                        npfr[LexA]LA_GT_F (P1): 5’ + CATGTCTCGCCTTGATGTGCTGC 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npfr[LexA]LA_GT_R (P2): 5’ + AAAGCCCAGTCGCTGTGCTATCT 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npfr[LexA]RA_GT_F (P3): 5’ + TCAAATACCCTTGGATCGAAGTAAA 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npfr[LexA]RA_GT_R (P4): 5’ + CACAGCGAGAAGATCGAGTAGTAGAA 3’

                                                                        +
                                                                        • +
                                                                      +

                                                                      The following primers were used to + amplify npfr cDNA, which we + obtained by performing RT-PCR using mRNA extracted from npfrLexA and control flies:

                                                                      +
                                                                        +
                                                                      • +

                                                                        npfr_Deletion_F1 (P5): 5’ + CACCTCGGATCTGAATGAGACTGG 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npfr_Deletion_R1 (P6): 5’ + AGACGATTAGCACGCCGTACATG 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npfr_Deletion_F2 (P7): 5’ + CACCCTGGTTGTTATAGCCGTCAT 3’

                                                                        +
                                                                        • +
                                                                      • +

                                                                        npfr_Deletion_R2 (P8): 5’ + ACGCACAGCGAGAAGATCGAGTAG 3’

                                                                        +
                                                                        • +
                                                                      +

                                                                      Generation of P[g-npf+] transgenic flies

                                                                      +

                                                                      We obtained a plasmid covering 20,306 + bp of the npf genomic region + from P[acman] Resources (http://www.pacmanfly.org/libraries.html). The + P[acman] BAC CH322-163E17 plasmid, and a plasmid source of phiC31 were co-injected into a strain (BDSC + #9723) with an attP40 site + (BestGene Plan H).

                                                                      +

                                                                      + Immunohistochemistry

                                                                      +

                                                                      Fly brains were dissected in ice-cold + phosphate-buffered saline (PBS, pH 7.4, diluted from a sterile filtered 10x PBS stock, + cat#:119-069-131, Quality Biological, Inc. 1x working concentration contains 137 mM NaCl, 2.7 mM + KCl, 2 mM KH2PO4, 8 mM Na2HPO4) and fixed in 4 % paraformaldehyde in + PBST (0.3 % Triton X-100 in PBS) at room temperature for ~ 20 min. Brains were washed three + times in PBST for 20 min each time, and blocked in 5 % normal goat serum in PBST for 1 hr. The + brains were incubated with primary antibodies diluted in 5 % normal goat serum in PBST for 24 hr + at 4 °C. Samples were washed three times with PBST before applying secondary antibodies for 3 hr + at 25 °C in darkness. After washing three times with PBST, the samples were mounted with + VectaShield (Vector Labs) on glass slides. The primary antibodies were chicken anti-GFP (1:1000, + Invitrogen, A-10262), rabbit anti-DsRed (1:1000, Clontech, 632496), mouse nc82 (1:250, + Developmental Studies Hybridoma Bank), rabbit anti-FruM (1:10000) (Stockinger et al., 2005), + rat anti-DsxM (1:500) (Hempel and Oliver, 2007) rabbit anti-NPF (1:250 ABIN641365), and + mouse anti-V5 (1:500 DyLight549 tagged, MCA2894D549GA BioRad). The secondary antibodies were + AlexaFluor 488 goat anti-chicken (1:1000; Invitrogen, A-11039), AlexaFluor 488 goat anti-rat + (1:1000; Invitrogen, A-11006), AlexaFluor 568 goat anti-rabbit (1:1000; Invitrogen, A-11011), + AlexaFluor 633 goat anti-mouse (1:1000; Invitrogen, A-21050), Rhodamine Red-X goat anti rabbit + IgG (1:1000; Molecular Probe, R6394). We adapted a previously described method for anti-V5 and + anti-GFP double staining (Nern et al., 2015). Briefly, we first used chicken anti-GFP as the + primary antibodies (1:1000, Invitrogen, A-10262) for 24 hr 4 °C. We washed the brains three + times with PBST, and then added AlexaFluor 488 goat anti-chicken IgG (1:1000; Invitrogen, + A-11039) and DyLight549 tagged mouse anti-V5 antibodies (1:500 DyLight549 tagged, MCA2894D549GA + BioRad). The brains were incubated at 25 °C for 3 hr in darkness, washed three times in PBST, + and mounted with VectaShield (Vector Labs) on glass slides. We performed the imaging using a + Zeiss LSM 700 confocal microscope, and processed the images using ImageJ.

                                                                      +

                                                                      GRASP analysis +

                                                                      +

                                                                      To detect native GRASP GFP + fluorescence in brains, we used flies aged for ~ 20 days to enhance the reconstructed GFP + signals. We dissected the brains in ice-cold PBS, fixed the tissue for 20 min in 4 % + paraformaldehyde in PBST at 25 °C, washed three times with PBST, and mounted the brains in PBS + for imaging the native fluorescent signals.

                                                                      +

                                                                      Ex vivo + Ca2+ imaging

                                                                      +

                                                                      We dissected brains from 7 to 15 + day-old males (separated from females for 5 days, raised in ~ 10 male-only group) in cold Drosophila imaging saline (108 + mM NaCl, 5 mM KCl, 2 mM CaCl2, 8.2 mM MgCl2, 4 mM NaHCO3, 1 mM NaH2PO45 mM trehalose, 10 mM sucrose, 5 mM HEPES, + pH = 7.5 (Inagaki et + al., 2014), transferred individual brains to 35 mm plastic Petri dishes (35 3001 + Falcon), attached the brain down to the bottom of the dish with a slice harp (SHD-26GH/10, + Warner Instruments), and bathed each brain in 2 ml Drosophila imaging saline. We imaged the + Ca2+ dynamics using a + Zeiss LSM 700 confocal microscope. The images were acquired using a Zeiss 20x water objective + (20x/1.0 DIC (uv) VIS-IR, Zeiss) and a 488 nm laser, with the anterior side of the brain facing + up to the objective. The images were acquired at a 128 × 128 pixel resolution, and at a frame + rate of ~ 10 Hz.~ 10 Z axial sections were imaged in one time-series cycle. The section interval + was ~ 1 μm. The time intervals between each cycle were 2 s.

                                                                      +

                                                                      Before stimulating a brain, we imaged + the basal GCaMP3 signals for ≥ 10 cycles. We then gently added 200 μl 50 mM ATP (pH adjusted to + 7.0, Sigma, A2383-5G) into the Drosophila imaging saline, resulting in a + final ATP concentration of 5 mM. We performed a stack registration using the ImageJ Plugins + registration module and measured the GCaMP3 intensities using the ImageJ Analyze ROI manager + module. ΔF/F0 (%) was + calculated as ΔF/F0 + (%)=(F-F0)/F0 × 100. Fmax is the maximum fluorescence value + following ATP delivery. Fmin is the minimum fluorescence value that + occurred during a total of 80 time series cycles after ATP delivery. F0 is the GCaMP3 baseline value averaged for + 10 time-series cycles immediately before ATP application.

                                                                      +

                                                                      Statistical + analyses

                                                                      +

                                                                      No statistical methods were employed + to predetermine sample sizes. Sample sizes were chosen based on previous publications (Demir and Dickson, + 2005; Manoli et al., 2005; Stockinger et al., 2005; + Pan et al., + 2012; Asahina et al., 2014; Clowney et al., 2015; Huang et al., + 2016; Zhang et al., 2016). Statistical analysis was performed with Prism5 + (GraphPad Software). We performed nonparametric Mann-Whitney test when comparing two groups of + data. For comparison of multiple groups of data, we performed Kruskal-Wallis test followed by + Dunn’s post hoc test. * + indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001. We present the + exact number of samples and P + values in the figure legends and in the supporting source data files. We present raw data using + scatter plots and include exact values in the source data files. When n < 10, individual data + points were identified.

                                                                      +

                                                                      Replication

                                                                      +

                                                                      We used only biological replicates + throughout this work. To perform the behavioral studies, we defined biological replicates as + animals of the same genotype and rearing conditions, exposed to identical treatments. Courtship + indexes were calculated using n = 6—27 individual animals. Preference indexes were calculated + using n = 12 individual animals. Chaining indexes were calculated using n = 6 groups (8—12 + individual animals in each group). Lunging numbers were calculated using n = 10—12 animals. All + animals were used once, since their behavioral indexes are sensitive to prior experience. + Replicates for the Ca2+ + imaging were defined as the number of neurons (Figure 6C and F) or the selected regions (Figure 8E) analyzed per + genotype and condition. In all cases we used 3—9 brains/genotype and condition. 2—5 neurons (Figure 6C and F) or 4—7 + regions of selection (Figure 8E) were used per brain. Replicates for the + immunostaining were defined as brains of the same genotype that underwent identical staining + procedures. We stained ≥ 5 brains per experiment. The Gal4/UAS (or LexA/LexAop) binary systems are highly + reproducible. Images that were the most intact were selected for display. We did not exclude any + data points.

                                                                      +

                                                                      Group allocation +

                                                                      +

                                                                      To perform the behavioral assays, the + control and experimental groups were reared under the same conditions, collected on the same + day, aged in parallel, and assayed on the same day. The control and experimental groups were + assayed in an arbitrary order. Behavioral videos were randomly permuted for scoring behavioral + indexes. All behavioral analyses were obtained from videos, in which the genotypes were masked. + The indexes were calculated blindly.

                                                                      +

                                                                      To perform the Ca2+ imaging, the control and experimental + groups were assayed in an arbitrary order. The raw Ca2+ imaging data files were permutated in + order and analyzed by Image J software.

                                                                      +

                                                                      Source data + files

                                                                      +

                                                                      The raw data for the behavioral + assays, Ca2+ imaging + assays, summary statistics, and full stacks of the entire brains used in the GRASP experiments + are included in the source data files.

                                                                      +
                                                                      +

                                                                      References

                                                                      +
                                                                        +
                                                                      1. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        The continuing case for the Renshaw cell + +
                                                                          + + +
                                                                        + +
                                                                        2. +
                                                                      2. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Tachykinin-expressing neurons control male-specific + aggressive arousal in Drosophila + +
                                                                          + + + + + + + + +
                                                                        + +
                                                                        3. +
                                                                      3. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Altered electrical properties in Drosophila neurons + developing without synaptic transmission + +
                                                                          + + + + + +
                                                                        + +
                                                                        4. +
                                                                      4. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        FlyMAD: rapid thermogenetic control of neuronal activity in + freely walking Drosophila + +
                                                                          + + + + + + +
                                                                        + +
                                                                        5. +
                                                                      5. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Targeted gene expression as a means of altering cell fates + and generating dominant phenotypes + +
                                                                          + + +
                                                                        + +
                                                                        6. +
                                                                      6. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Identification of a Drosophila brain-gut peptide related to + the neuropeptide Y family + +
                                                                          + + + + + + +
                                                                        + +
                                                                        7. +
                                                                      7. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        + + Drosophila doublesex gene controls somatic sexual differentiation by producing + alternatively spliced mRNAs encoding related sex-specific polypeptides + +
                                                                          + + +
                                                                        + +
                                                                        8. +
                                                                      8. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        + + The interstitial nuclei of the human anterior hypothalamus: an investigation of sexual + variation in volume and cell size, number and density + +
                                                                          + + + + + + + + +
                                                                        + +
                                                                        9. +
                                                                      9. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Multimodal chemosensory circuits controlling male courtship + in Drosophila + +
                                                                          + + + + + +
                                                                        + +
                                                                        10. +
                                                                      10. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        + + A second function of gamma frequency oscillations: an E%-max winner-take-all mechanism + selects which cells fire + +
                                                                          + + + +
                                                                        + +
                                                                        11. +
                                                                      11. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        fruitless splicing specifies male courtship behavior in + Drosophila + +
                                                                          + + +
                                                                        + +
                                                                        12. +
                                                                      12. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Wired for sex: the neurobiology of Drosophila mating + decisions + +
                                                                          + +
                                                                        + +
                                                                        13. +
                                                                      13. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Serotonin and neuropeptide F have opposite modulatory + effects on fly aggression + +
                                                                          + + +
                                                                        + +
                                                                        14. +
                                                                      14. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        + + GFP reconstitution across synaptic partners (GRASP) defines cell contacts and synapses in + living nervous systems + +
                                                                          + + + + + + + +
                                                                        + +
                                                                        15. +
                                                                      15. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        A transcriptional reporter of intracellular Ca2+ in + Drosophila + +
                                                                          + + + + + + +
                                                                        + +
                                                                        16. +
                                                                      16. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        A sex difference in the hypothalamic uncinate nucleus: + relationship to gender identity + +
                                                                          + + +
                                                                        + +
                                                                        17. +
                                                                      17. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Characterization of a functional neuropeptide F receptor + from Drosophila melanogaster + +
                                                                          + + + + + +
                                                                        + +
                                                                        18. +
                                                                      18. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Motor control in a Drosophila taste circuit + +
                                                                          + + +
                                                                        + +
                                                                        19. +
                                                                      19. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Temperature-sensitive mutations in Drosophila melanogaster. + XIV. A selection of immobile adults + +
                                                                          + + + + +
                                                                        + +
                                                                        20. +
                                                                      20. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        + + Investigating the function of follicular subpopulations during Drosophila oogenesis + through hormone-dependent enhancer-targeted cell ablation + +
                                                                          + + + +
                                                                        + +
                                                                        21. +
                                                                      21. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Sex-specific DoublesexM expression in subsets of Drosophila + somatic gonad cells + +
                                                                          + + +
                                                                        + +
                                                                        22. +
                                                                      22. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        P1 interneurons promote a persistent internal state that + enhances inter-male aggression in Drosophila + +
                                                                          + + + + + +
                                                                        + +
                                                                        23. +
                                                                      23. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Courtship in Drosophila mosaics: sex-specific foci for + sequential action patterns + +
                                                                          + + +
                                                                        + +
                                                                        24. +
                                                                      24. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Neuromodulation of courtship drive through + tyramine-responsive neurons in the Drosophila brain + +
                                                                          + + + + + +
                                                                        + +
                                                                        25. +
                                                                      25. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        + + Optogenetic control of Drosophila using a red-shifted channelrhodopsin reveals + experience-dependent influences on courtship + +
                                                                          + + + + + + + + +
                                                                        + +
                                                                        26. +
                                                                      26. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        + + Sexual orientation in Drosophila is altered by the satori mutation in the + sex-determination gene fruitless that encodes a zinc finger protein with a BTB + domain + +
                                                                          + + + + + + +
                                                                        + +
                                                                        27. +
                                                                      27. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Excitation and inhibition onto central courtship neurons + biases Drosophila mate choice + +
                                                                          + + + +
                                                                        + +
                                                                        28. +
                                                                      28. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        + + A PDF/NPF neuropeptide signaling circuitry of male Drosophila melanogaster controls + rival-induced prolonged mating + +
                                                                          + + + +
                                                                        + +
                                                                        29. +
                                                                      29. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Fruitless and doublesex coordinate to generate male-specific + neurons that can initiate courtship + +
                                                                          + + + + + +
                                                                        + +
                                                                        30. +
                                                                      30. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        + + Conditional modification of behavior in Drosophila by targeted expression of a + temperature-sensitive shibire allele in defined neurons + +
                                                                          + +
                                                                        + +
                                                                        31. +
                                                                      31. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Female contact activates male-specific interneurons that + trigger stereotypic courtship behavior in Drosophila + +
                                                                          + + + +
                                                                        + +
                                                                        32. +
                                                                      32. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        + + Visually induced initiation of Drosophila innate courtship-like following pursuit is + mediated by central excitatory state + +
                                                                          + + +
                                                                        + +
                                                                        33. +
                                                                      33. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Highly improved gene targeting by germline-specific Cas9 + expression in Drosophila + +
                                                                          + + +
                                                                        + +
                                                                        34. +
                                                                      34. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Aggression in Drosophila + +
                                                                          + + +
                                                                        + +
                                                                        35. +
                                                                      35. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        + + Two distinct pools of synaptic vesicles in single presynaptic boutons in a + temperature-sensitive Drosophila mutant, shibire + +
                                                                          + + +
                                                                        + +
                                                                        36. +
                                                                      36. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        + + Spatial, temporal, and sexually dimorphic expression patterns of the fruitless gene in the + Drosophila central nervous system + +
                                                                          + + + + + + +
                                                                        + +
                                                                        37. +
                                                                      37. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Sex- and clock-controlled expression of the neuropeptide F + gene in Drosophila + +
                                                                          + + + +
                                                                        + +
                                                                        38. +
                                                                      38. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        A difference in hypothalamic structure between heterosexual + and homosexual men + +
                                                                          + +
                                                                        + +
                                                                        39. +
                                                                      39. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Remote control of behavior through genetically targeted + photostimulation of neurons + +
                                                                          + + +
                                                                        + +
                                                                        40. +
                                                                      40. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Social regulation of aggression by pheromonal activation of + Or65a olfactory neurons in Drosophila + +
                                                                          + + + + + + + +
                                                                        + +
                                                                        41. +
                                                                      41. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Male-specific fruitless specifies the neural substrates of + Drosophila courtship behaviour + +
                                                                          + + + + + + +
                                                                        + +
                                                                        42. +
                                                                      42. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        + + A comparative review of short and long neuropeptide F signaling in invertebrates: any + similarities to vertebrate neuropeptide Y signaling? + +
                                                                          + + +
                                                                        + +
                                                                        43. +
                                                                      43. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        + + Optimized tools for multicolor stochastic labeling reveal diverse stereotyped cell + arrangements in the fly visual system + +
                                                                          + + + +
                                                                        + +
                                                                        44. +
                                                                      44. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Genetically encoded dendritic marker sheds light on neuronal + connectivity in Drosophila + +
                                                                          + + + + + + + + + +
                                                                        + +
                                                                        45. +
                                                                      45. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        + + Electrical hyperexcitation of lateral ventral pacemaker neurons desynchronizes downstream + circadian oscillators in the fly circadian circuit and induces multiple behavioral + periods + +
                                                                          + + + + + + + + +
                                                                        + +
                                                                        46. +
                                                                      46. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Joint control of Drosophila male courtship behavior by + motion cues and activation of male-specific P1 neurons + +
                                                                          + + + +
                                                                        + +
                                                                        47. +
                                                                      47. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Feedback inhibition enables θ-nested γ oscillations and grid + firing fields + +
                                                                          + + + + +
                                                                        + +
                                                                        48. +
                                                                      48. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Courtship behavior in Drosophila melanogaster: towards a + 'courtship connectome' + +
                                                                          + + +
                                                                        + +
                                                                        49. +
                                                                      49. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        + + Reversible alteration in the neuromuscular junctions of Drosophila melanogaster bearing a + temperature-sensitive mutation, shibire + +
                                                                          + + +
                                                                        + +
                                                                        50. +
                                                                      50. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Routing of spike series by dynamic circuits in the + hippocampus + +
                                                                          + + +
                                                                        + +
                                                                        51. +
                                                                      51. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Optimized gene editing technology for Drosophila + melanogaster using germ line-specific Cas9 + +
                                                                          + + + + + + + + + + + + + + + + + +
                                                                        + +
                                                                        52. +
                                                                      52. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Control of sexual differentiation and behavior by the + doublesex gene in Drosophila melanogaster + +
                                                                          + + + + + +
                                                                        + +
                                                                        53. +
                                                                      53. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Sex and the single cell. II. there is a time and place for + sex + +
                                                                          + + + + +
                                                                        + +
                                                                        54. +
                                                                      54. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Control of male sexual behavior and sexual orientation in + Drosophila by the fruitless gene + +
                                                                          + + + + + + + + + +
                                                                        + +
                                                                        55. +
                                                                      55. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Sexual deprivation increases ethanol intake in + Drosophila + +
                                                                          + + + + + +
                                                                        + +
                                                                        56. +
                                                                      56. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Neural circuitry that governs Drosophila male courtship + behavior + +
                                                                          + + + + + +
                                                                        + +
                                                                        57. +
                                                                      57. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Experiments on sex recognition and the problem of sexual + selection in Drosophila + +
                                                                          + +
                                                                        + +
                                                                        58. +
                                                                      58. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Dynamin-like protein encoded by the Drosophila shibire gene + associated with vesicular traffic + +
                                                                          + + +
                                                                        + +
                                                                        59. +
                                                                      59. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Neurogenetics of courtship and mating in Drosophila + +
                                                                          + + +
                                                                        + +
                                                                        60. +
                                                                      60. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Opposite thermosensor in fruitfly and mouse + +
                                                                          + + + + + + + + +
                                                                        + +
                                                                        61. +
                                                                      61. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Neuronal control of Drosophila courtship song + +
                                                                          + + + + + + +
                                                                        + +
                                                                        62. +
                                                                      62. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Drosophila spichthyin inhibits BMP signaling and regulates + synaptic growth and axonal microtubules + +
                                                                          + + + + + +
                                                                        + +
                                                                        63. +
                                                                      63. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        A common genetic target for environmental and heritable + influences on aggressiveness in Drosophila + +
                                                                          + + + + +
                                                                        + +
                                                                        64. +
                                                                      64. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        + + A circuit node that integrates convergent input from neuromodulatory and social + Behavior-Promoting neurons to control aggression in Drosophila + +
                                                                          + + + + + + + +
                                                                        + +
                                                                        65. +
                                                                      65. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Spatial representation of the glomerular map in the + Drosophila protocerebrum + +
                                                                          + + + +
                                                                        + +
                                                                        66. +
                                                                      66. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Developmental control of foraging and social behavior by the + Drosophila neuropeptide Y-like system + +
                                                                          + + + + + + +
                                                                        + +
                                                                        67. +
                                                                      67. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Genes and circuits of courtship behaviour in Drosophila + males + +
                                                                          + + +
                                                                        + +
                                                                        68. +
                                                                      68. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Analysis of functional neuronal connectivity in the + Drosophila brain + +
                                                                          + + + + + +
                                                                        + +
                                                                        69. +
                                                                      69. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Cellular organization of the neural circuit that drives + Drosophila courtship behavior + +
                                                                          + + + + + +
                                                                        + +
                                                                        70. +
                                                                      70. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Dopaminergic circuitry underlying mating drive + +
                                                                          + + + +
                                                                        + +
                                                                        71. +
                                                                      71. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        A subset of octopaminergic neurons are important for + Drosophila aggression + +
                                                                          + + + +
                                                                        + +
                                                                        72. +
                                                                      72. +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        Central neural circuitry mediating courtship song perception + in male Drosophila + +
                                                                          + + + + + + +
                                                                        + +
                                                                        73. +
                                                                      +
                                                                      + \ No newline at end of file diff --git a/src/examples/article-kitchen-sink.html b/src/examples/article-kitchen-sink.html index 39952c0a5..de993a750 100644 --- a/src/examples/article-kitchen-sink.html +++ b/src/examples/article-kitchen-sink.html @@ -1,495 +1,462 @@ - - - - Title of the article - - - - - - - - - - -
                                                                      -
                                                                      - -
                                                                      - -
                                                                      -
                                                                      -

                                                                      Title of the article

                                                                      - -
                                                                        - - +
                                                                        +
                                                                        + +
                                                                        + +
                                                                        +
                                                                        +

                                                                        Title of the article

                                                                        + +
                                                                          + +
                                                                        - - - +
                                                                        42 + 
                                                                        Hello
                                                                        [1,2,3]
                                                                        + +
                                                                        +

                                                                        References

                                                                        +
                                                                          +
                                                                        1. +
                                                                          + +
                                                                          + +
                                                                          +
                                                                          The continuing case for the Renshaw cell + +
                                                                            + + +
                                                                          + +
                                                                          2. +
                                                                        2. +
                                                                          + +
                                                                          + +
                                                                          +
                                                                          Tachykinin-expressing neurons control male-specific + aggressive arousal in Drosophila + +
                                                                            + + + + + + + + +
                                                                          + +
                                                                          3. +
                                                                        3. +
                                                                          + +
                                                                          + +
                                                                          +
                                                                          + + Altered electrical properties in Drosophila neurons developing without synaptic + transmission. Lorem, ipsum dolor sit amet consectetur adipisicing elit. Aut molestiae quo, + numquam tempora veniam iusto sit nobis repudiandae eum deleniti laboriosam ipsa quasi id + vitae velit perferendis quas perspiciatis corrupti. + +
                                                                            + + + + + +
                                                                          + +
                                                                          4. +
                                                                        +
                                                                        +
                                                                      \ No newline at end of file diff --git a/src/examples/generate.sh b/src/examples/generate.sh index 44e31ca86..5af20fd07 100755 --- a/src/examples/generate.sh +++ b/src/examples/generate.sh @@ -1,21 +1,17 @@ #!/bin/sh # Generate article-kitchen-sink.html -npx encoda convert article-kitchen-sink.json article-kitchen-sink.html +npx encoda convert article-kitchen-sink.json article-kitchen-sink.html --standalone=false # Generate article-drosophila.html -npx encoda convert https://elifesciences.org/articles/49574v2 article-drosophila.html +npx encoda convert https://elifesciences.org/articles/49574v2 article-drosophila.html --standalone=false # Generate article-antibodies.html -npx encoda convert 'https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1007207' article-antibodies.html +npx encoda convert 'https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1007207' article-antibodies.html --standalone=false # Generate article-rmarkdown.html # Temporarily excluded becuase, with removal of `coerce()` call from `xmd` codec # the metadata is causing this to fail. # curl -o rmarkdown.nb.html https://raw.githubusercontent.com/stencila/examples/master/rmarkdown/rmarkdown.nb.html -# npx encoda convert rmarkdown.nb.html --from rnb article-rmarkdown.html +# npx encoda convert rmarkdown.nb.html --from rnb article-rmarkdown.html --standalone=false # rm rmarkdown.nb.html - -# Replace unpkg Thema packages with local versions for development. Swapping out JavaScript files for TypeScript -perl -pi -w -e 's/https:\/\/unpkg.com\/\@stencila\/thema\@1\/dist\/(.+\/index)\.js/\.\.\/$1\.ts/g;' *.html -perl -pi -w -e 's/https:\/\/unpkg.com\/\@stencila\/thema\@1\/dist/\.\./g;' *.html diff --git a/src/examples/index.ts b/src/examples/index.ts index ed890ad56..5a24abdb2 100644 --- a/src/examples/index.ts +++ b/src/examples/index.ts @@ -1,5 +1,5 @@ export const examples: { [key: string]: string } = { - 'article-kitchen-sink': '/examples/article-kitchen-sink.html', - 'article-antibodies': '/examples/article-antibodies.html', - 'article-drosophila': '/examples/article-drosophila.html' + 'article-kitchen-sink': 'examples/article-kitchen-sink.html', + 'article-antibodies': 'examples/article-antibodies.html', + 'article-drosophila': 'examples/article-drosophila.html' } diff --git a/src/index.html b/src/index.html index bc6091f96..f779764f0 100644 --- a/src/index.html +++ b/src/index.html @@ -32,12 +32,14 @@ class="theme" rel="stylesheet" href="./themes/stencila/styles.css" + disabled />